GenePrediction:GLEAN_1885 Details

Name: GLEAN_1885
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1725575..1726000 (+ strand)
Length: 426
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1725575..1725582 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_144:1725647..1725716 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_144:1725812..1726000 (+ strand)
Length: 189
>GLEAN_1885 class=GenePrediction position=GCSC_144:1725575..1726000 (+ strand)
ATGGACGGGTACGTGAAGGGCGGCGGTTTTGCAGAGGTGCCGTCGATGCGCCAGGCTAACATTGCATCGCAGCCTCACAT
CGGCCGAGACGCGCGAGTTGGAGCAGCGGCTGCAGAAGCGGCAGGTCAAGGAGTTTATCGGGGTGAGTTTGTGTTGTGAG
AATTTATTTCCTTTCCTTCCTTTCCTCTCTCCTCTCTCCTCTCTCCTCTCTCCTCTCTTCCCCACTAACCAACTCAGCTC
TTTAGCAACCTCGTGGACAACTGCTTCACGGCGTGCGTAGACGACTTCTCGTCCAAGGCGGTGTCGACACGTGAGACGGG
CTGCATCACACGATGCGTGCAAAAGACGCTGGCGACGCAGCAGCGATTGTCGGAGCGGTTCCAGGAACACAACGCGGAGA
TGAGCCAGCAGCAGCAGCCACGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62