GenePrediction:GLEAN_1887 Details

Name: GLEAN_1887
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1737661..1738828 (+ strand)
Length: 1168
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1737661..1738099 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_144:1738168..1738271 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_144:1738337..1738642 (+ strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_144:1738718..1738828 (+ strand)
Length: 111
>GLEAN_1887 class=GenePrediction position=GCSC_144:1737661..1738828 (+ strand)
ATGCCGGTCTCGTCGGGCGGCGCCTGCCGGCAAAAGTTGGTCATGGCTGGCATCACCGTCGCCGTGGCCGGCAGTCTGGG
CTCCGGCTGGACTGACGCGGACGTGGCCCGCTGGATGGCCTACAATGGCGGGCGGTTTGCCGCGTCCGTCACTGGCGACG
TGACACATCTGCTCTGCACGCCGGAGGAGTACGCCAGGCCCAAGAAGAAGCAGGACCCGGCCCTGCGGGAGGCCCTACGG
CGCGGCCCCAAAAATGTGCACATTGTGCTCAAGGACTGGCTCGAAGACTCGCTGCACAGGCGCAGTCGCCGTCGCGAGAA
GGCCTACCTGCTGCGACACATCCACCGCCCGTCCCAGCAGCACCACAAGGAGATGCAGGAGCGTCAGGAGCGGCTGCGTG
CAAAGGGCCGGCAGCTTGGCGAGACATTTGTAGATACAAGTGGGTGATGTGAAATTAAATCAAAACAAATACTAATTAAT
GTTGAAAAAAAATGTTAACTTGTACAGCTCTCTACCACATCTATCAGGACGCCACCGGCTTCTCCTACAAGGTAACCATC
CAGCGCGATCACGAAAACTGCGGCATCTTTGGCGAACGTTACGTCCTTCATGTAAGTGTGGTGCTTTTTAGAATTGGCAA
CCGTTTTCGCTGACACAATTTCCCCGCCCATCACAGCTTTTCGAGTCGGATGCCCGGCCACATCTTTACTGGTTTGCCGC
CCGCCACTACAAGAGCCGTACACACACGCAGCCACGAGACTACCGGCCCAGCGACACCTGCCGGTTATTTGAGACTGAGT
TTCGGCATTTCTGCACCTTCTTTGCCAGGAAGACCGGCGTGTCCTGGGACGAGAGGATGGTAGCAGAAGCCCCGACAAAG
ACGATGAAGGATACAAATACGAAGGAGGCCGATGTTCACGACCTGTCCGTCATTCTCGACTTCGGACCAGAGACGTCCAG
CTATTTCCGATACGTGAGGCCGGTGGGTCTCTATTTTTGTGCCTTTCCGAGCAGGTCTCTGTTTTTGCTAGTTGCGCTAA
CCGAGAGGGGAATGCAGGCCAGAGGCATGCCCATGGGCGTTATTGACAAGGCGGAGAACATGCCCCGTCCCAATATAGAG
GAAATCAATCTGGACGGAGGGTACGAGCAGGGGCAGAGACATGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62