GenePrediction:GLEAN_1889 Details

Name: GLEAN_1889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1744304..1747863 (+ strand)
Length: 3560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1744304..1744383 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_144:1744442..1744628 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_144:1744698..1747503 (+ strand)
Length: 2806
Type: CDS
Source: GLEAN
Position: GCSC_144:1747554..1747758 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_144:1747824..1747863 (+ strand)
Length: 40
>GLEAN_1889 class=GenePrediction position=GCSC_144:1744304..1747863 (+ strand)
ATGTCGTGGGACTTGCTGCAGCGATTATTTGAGAGCGACGTCTTCAACTCCAATCCCTTTCTCCCCGTTTCCTACCTCTC
GTGAGTCTTGTCACATCCTCCTGCTGTCTGCTGCCTCTTCTTGCTGACCGGCCTCTAGTCGATATGCCGATCATGTGGGC
ATTCATTATGTGCTCTGCAATAAGCTGCGCCAGTTCCCCTACGAGGACATTGAGTTCTTCCTCCCCCAGCTCTGCCACCT
CATAATCAGCGTCAACAATGAGTCAATGGCCCTGGAGGGATTTCTCCTCGATCTCTGCGAGGAGTCTGTGACTGCAGCCT
TGCTTGTTAGTCTCTCCATCATTCCTGTTCTGAGCCGCCATAAGCCGATTAATCACTAACAGCTCCTCCTTCAGACCTTC
TGGCTCTTCCAGACATACTTGCACGACCTTTCCTCTAACCCCCAGACCGACGCGTTCCAGACCTGCCGCCGCGTCTATAA
CAAGGTCCAGCACATTGTTTTCGGTCTGCCTGATGCCACCAGCCCCGACAAGATCAGCGAGAATGTCCTCCCTGTCACTG
TCCTTGCCAGCTTTGTTCTCGCTAGCATCGGTGCGCCCTTCCTGCCTCGATGGGCCGGGCCACTGGCCATTGCTCAGGCC
CGCAAACCATCTCCACCTGAGACAGTCAATGCTACGGCCGCTGCGGTCACTCCGCCAGGCACGGAAGCCACCGATGCTTC
CCCAGGTTCAGGCACGTTCGCAAGACCGACCCGTTCCCATACGATCGCCATGGTGCCCACTAAGCCCAGACGTACCAAGG
ATGAGACCAGAGGCAGTTCCCGGCCGTTGGGCTCGATCCGACAACACTCAAACCCGTCCGTGGATTCAATATCGTCGCCG
AGACAGGCAAAACACAAACATCGGCCGAACCAGCAGCAGCAGCCACAGTCTCTGTCACGACCGGGATCGTCTTCGAGCAT
GATTGCACTGCCGTCGCCTCTTGTGGACCTGCAAAATACCTTTCGGCCGTTACCACTGCCAACACCGACCCACCACTTGG
ATAGCATCTCATCAGAAGCCCGGATGAGCACAGCATCTCTACCGCTGCCCGACCTGCGAACGCCTCACATGGTCACGAGA
CCACCTACACCTGTGTCTGCCGGCCTGCGTCCAGACGAATCGGCCGCATCCGCTCTGGCTCGTCGCCACTCCCACCACGC
CAAGACGCGACTGGTCAGCGTGGCTGATTTGAGCCCCGAGAGCCGCGTCCGACTCCTGCGACAGAACTACTTCCGCTGCC
AGACGCAGTTCCTGCGGGCCTTGGAAGACATTTCCAACCGCCTGGTCGCCGTGCCAAAACCCGCACGGCTCAGCGCCCTC
CGCGCCGAGCTCGCCCTCATCTCCCAGGACCTGCCAGCAGAGGTGGATATCCCTATCATCTGTCCGCCAACCCTGGTGAA
TGGCTCTCCGAGCCGGAGCCGGCATCATCGCATCGTCCGCCTCAACCCGGCCGAAGCTACAGTGCTCAACAGCGCCGAAA
AGGTCCCATACCTCCTCATGGTAGAGATTTTGCGCGAGGACTTCACGTTCGACCCGGAATCGTCCGACAACCACCGGCTG
CTGACCTCCCTGGTGACGGAACAAGGTTCGCGGAGACGCATATTCGATCTCTCCGACTCGGTACAGAACGGCAACTCGTC
CCGTGCGTCCGATGCTGCAGCGGCGGCAGCTGCTGCTGCATCACTAGAGCCCCCCATCGACAGTGTATTTGAGCCCACTT
CTGGTGACCTCGGCAGCTCTCCGCTTATAAAACCGTTTGAGGAGGACGAGGAAGGTGGCGAGTTGCCCGCGCCAGGGAGA
ACACCATCAGGTACTCCCCACCGAGGAATGTCTACTCCGACCAATCGCCATACGATCAGTGGTATGCCAGGCTCAATGTC
TTCAGTTGCTGCCACCACGGTCACGGCTGCCACCACCTTCGCAGACAGCACACCACGGAGCTCAGCCGCGTCCACATCGC
GGTCTAGCAGTCCTGCACCCCGGCTACGCAAGATGACACTGCCCCTATCTCGTGGCCAGCACACGGCGGATCAGCCCGAC
TTTTCGGCCTTGGCCACGCACATGCGGACAGCATCGCAAATGCTAGCTCAGCTCGAGGCAACAAGCGGCAAGCGACCGCG
CCATGAGGTGGCAGCAATTCGTGCCAAAATCATCGCCAGCATGCAGAGCCTCGAGGAGCAGAGCTTCGACCTGGACGACG
GGCAGGGACCGACTTTCGACCTAATTATAGCTAAGGCGACCGCGGCCAACGTTGCTGCTGCCGCAGCCGCGGTAGTCGAT
ACGGTGGCCGAGTCTGCTGAGGGCTCGACATCGGCCACGCCGGTAGCCGGTAGCGAGGACGCCGATGACGACACGGCAGC
AGCGGCAGAAGCTGCTGTTGCCGCGGGTGGAGATCGAGCGGCCGTGAATCCAAACGCAGGCATCGCGCGTATGGAGAACG
ACTTCAAGACAGGCGGTCTGCAGCGCAAAGGCGACCGAGACGACCCGAGCGCGGCAGTATTTGGCGAGGCTTGGGACCTG
AAGCGGGAGCGGATTCGGCGATCATCGCCATATGGATGGATGAAGAACTGGGATCTGGTCAGCATGATTGTCAAGACGGG
GGCGGACCTGCGGCAGGAGGCGTTTGCGTGCCAGCTGATCCTGGTGTGCGACAAGATCTGGAGGGAGGCAAGCGTGCCGG
TGTGGGTGAAGCTGATGCGGATCCTGGTAACGGGCGAATCGTCAGGGCTGATCGAGACGATCACCAATGGCGTGTCGCTG
CACTCGATCAAGCGCAGTCTAACGCTGTCGTCGATCGAGTCCGGTCAGAATCCGCGGCGGCGCATCGCGACGCTCAAGGA
CTACTTTGCCAAGGCGTTTGGCGCAGAGGACAGCGAGGCGTATCGAGCGGGTGTGGACGCCTTCAAGCGGTCACTGGCGG
CGTACAGCGTCATCTCGTATGTGCTGCAGCTCAAAGACCGGCACAACGGAAACGTGCTCGTGGACAACGAGGGCCACATC
ATCCACATCGACTTTGGCTTCATGCTGTCGAACTCGCCGGGATCAGTAGCCTTTGAAGCGGCGCCCTTCAAGTTGACGCA
TGAGTATGTCGAGGTGCTCGGCGGGCTGGGGTCGCCCGAGTTTGACGACTACAAGCGTCTGTGCAAGCAGGCCTTCCAAG
GTGCGTCGGACTTGCCATGTTTTCTCTTTCCTCTTTGCTAACCAGATTAGCCCTTCGGAGGTCGGCCGACAACATTATCG
ATCTCGTCAGCATGATGGGCCTCGGCTCCAAGATGCCGTGCTTCTCAGCAGGCGTCGTGCAGGCGACGGCAAACCTGAGG
CAGCGCTTTCAGCTGCACTTGAGCGCCGAGGATGCCGAGCAGTTCGTGGAGACGGAGCTGGTCGGCAAGTCGCTTGGAAG
CTACTACACCCGACTGTACGTCGCATACCTCCTGTTTCCTCCGTGTATTCCCTCTCATTCGCACGCTGACACCCCTGCAG
ATACGATACCTTCCAGTATAGGACCCAAGGAATCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62