GenePrediction:GLEAN_1890 Details

Name: GLEAN_1890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1751963..1752742 (+ strand)
Length: 780
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1751963..1752034 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_144:1752109..1752215 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_144:1752265..1752742 (+ strand)
Length: 478
>GLEAN_1890 class=GenePrediction position=GCSC_144:1751963..1752742 (+ strand)
ATGGCCATGATGCAAGAAGCACGCAGTACGGTCGAGCGCCTGGACAGACCGAGCGCCTACTTCAACAACAAGGTTTGTCG
TCGCCTCTTCTTTTCTCCTTTCCGTTAGCGGCCGTTCCCCGACTCACACAGAGCTCTCTCGATCAGAAACGCCGCAGAGA
CAACCATGGCCGTGGCGAGGACGAAGTCCCCGATAAACCGCAGGCGATCGACGACCCGCTAAGAAACGCGACGACTCTTT
ACGTCGGCAATCTGTAAGAAGATGCCCTTCTGGTTGGTAGTTTCTGGCTGACACGCGAGCAGTTCGTTCTACACGACCGA
GGAGCAGGTATACGAGCTCTTTTCCAAGTGTGGCGAGATCAAGCGTCTGGTCATGGGCCTCGACCGCTTTAACAAGACGC
CCTGCGGCTTCTGCTTCGTCGAGTACTACACGCACCAAGACGCGCTCGACTGCATGAAGTACATTGGCGGCACCAAGCTA
GACGAGCGCATCATCCGCACCGATCTGGACCCAGGCTTCGAGGAGGGCCGGCAGTACGGCCGTGGCCGGTCGGGTGGCCA
GGTGCGCGACGAATATCGCGACGACTACGACGAGGGTCGCGGCGGCCTGGGACGTGCGCTGCAGGCCGAGCAGCGGGCCG
AGCGCGAGCGCGAGCAGGAACGCGAGAACGAACGCCGTGAGCGTGACCAGCGCGAACGCGAGCGGGAACGGGGCGAGCGT
GGTGGTGGCCGAGACAGGGACGGAGACCGGGACAGGGATAACGGCTTTGACATCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62