GenePrediction:GLEAN_1891 Details

Name: GLEAN_1891
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1753987..1754616 (+ strand)
Length: 630
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1753987..1754171 (+ strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_144:1754253..1754616 (+ strand)
Length: 364
>GLEAN_1891 class=GenePrediction position=GCSC_144:1753987..1754616 (+ strand)
ATGTCCTACTACTTTGCCATTGTCGGCACGCAGGATAACCCGCTCTTCGAGTACGACTTCGGCACGTCCAAGCAGGGCGG
CGATGGCCTGGCGCACTTTTCCGAGCAGGCGCGCCATCTGAACCAATTTATCGTGCACAGCAGCCTCGATGTCGTCGAGG
AAGTGTTATGGGGGACCGGCCAGATGTGAGTCCTTCTTGGTCTTCCCCTTGGCGAACACACCGCTACTCTGTGCAGGACT
GGACTGACGAAGGTTCCTGTGATTAGGTACCTCAAGTGCGTAGACAAGTTCTTCCAAAATTACGTCTCTTGCTTCGTCAC
GGGCGCCAACACAAAATTCCTCCTCCTCCACACGCCATCTTCAGCCGCAAATGCCTATACCCCCGGCATCAACGGAGGCC
TTACGGGAGGCAACAGCTCTTCTGCAGCATCCGTCTCGTCGCGTGCGTCCACATCTATCGGTGCCAATCCCACGAGTGCG
GCTACCGAGGAGGCCATCAAGAACTTCTTTTTCGAAGTATACGAGAGCTGGGTCAAAGCAACAATGAACCCTTTCTACAA
GAACAACATGGAGATCAGCAGTCCTGTGTTCCGGGCTCGAGTAGCTGCTGCAGGAAAGAAATACCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62