GenePrediction:GLEAN_1893 Details

Name: GLEAN_1893
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1762432..1763563 (+ strand)
Length: 1132
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1762432..1762582 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_144:1762639..1762720 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_144:1762798..1763341 (+ strand)
Length: 544
Type: CDS
Source: GLEAN
Position: GCSC_144:1763414..1763563 (+ strand)
Length: 150
>GLEAN_1893 class=GenePrediction position=GCSC_144:1762432..1763563 (+ strand)
ATGGCCGACTTTCTCTCGCGCAGGTTCGTCGACGGGGTCTACATCCCCGCCGGCCTGCTCATCTTTGGCGTCTTCATCGT
CAAGCGGGAGTTTACGCTCTACGCAGTGACACTCGCCCTGGTTCTGGGCGCCGGCAAAGTCTTCTCGATGCGTATGTGGC
ACCGCCCAGGAAGCCCTCAGCTTGCCCGGGCTAACACTCGTGACCAGTGCCCAAGAAGGTCCTCGACCCCGTCAACTTCC
AGCAGTTCGAGCTCAAGGAGAAGACGATCATCTCGCACAACGTGGCCATGTGGGTTCTGCGCGGCTGTCTGTCCCCGGAA
GACTGGTGGGGTTTGCCTGGCTGACACGTACCCCAACAAAATACAGCTACCGCTTCAAGCTGCCGAGCCCGACCCATATT
CTCGGCCTGCCCATTGGCCAACACATCTCCATTGGCGCAGACCTGGCCGACGCCGACGGCAACGTCAAGTCTGTCCTGCG
CTCCTACACGCCCATCAGCGGCGACCACCAGCCGGGCTACTTTGACCTGCTCATCAAGTCGTACCCGCAGGGCAACATCA
GCAAGCACCTGGCCACGCTCGCCGTCGGCCAGACCATCCGCGTCAAGGGCCCCAAGGGCGCCTTTGTCTACACGCCCAAC
ATGGTTCGCCACTTCGGCATGGTGGCCGGCGGCACCGGCATCACGCCCATGCTGCAGGTCATCCGAGCCATCGTGCGCGG
CCGTTCTGCCGGCGACAAGACCGAGGTCGACCTCATCTTTGCCAACGTCACCCCCCAGGACATCTTGCTCAAGGAGGACC
TCGATGCCCTCGCACAGGAGGACAAGGGCATCCGTGTGCACTACGTCCTCGACCGGCCTCCTGAGGGCTGGACTGGCGGC
GTCGGCTACGTCACTGCCGACATGGTCAAGGTAAGACTCTCACTACAACGCTGCTTGCCGCTTTGCCGTGCTGCCGTCAT
CGTACTGACATATCTCTTCTAGCAATGGTTACCAAAGGCTGCCCCCGACGTCAAGATCCTGCTCTGTGGCCCTCCTCCCA
TGATCTCCGGTCTCAAGAAAACCACCGAGAGCCTCGGTTTCAACAAGGCCCGGCCTGTGAGCAAGCTGGAGGACCAGGTG
TTTGCTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62