GenePrediction:GLEAN_1894 Details

Name: GLEAN_1894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1766485..1769929 (+ strand)
Length: 3445
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1766485..1766595 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_144:1766668..1766775 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_144:1766853..1767163 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_144:1767315..1768695 (+ strand)
Length: 1381
Type: CDS
Source: GLEAN
Position: GCSC_144:1768758..1769321 (+ strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_144:1769381..1769929 (+ strand)
Length: 549
>GLEAN_1894 class=GenePrediction position=GCSC_144:1766485..1769929 (+ strand)
ATGGGCGACCTCCAGCCTCCGTATCTGACCATCCGGTCATTCAACAGCGGCAATGGAAGCAGGATGAACGGCGGTGGCGA
CGGAAACAGTCTGAGCAGCGCAGACTCTGCGGTGCGGTACACCCTCACTGCTCTTTATGAGCGAGCAGGATTCCTCCTGA
ATGTCGTGCTCTAACATAAACAGTATGCCTCGGCGAGCGGGGACTACACGGTCCCCTCCACGACACATGATATCAGTCGT
GCAAATTATCATGTCAAGCATCTTGATATGTTTGCCAAGTCCCTCGAGGATGTATGTAGCCGAAGCGGGAAGAGAGGCTT
TACCTGTTTGCACGTCATCCTCGCGCTAACCTACGCTCCTGGATCAAGTCGGCCAGTCGTGCCTTTCCTAATCGTGGCCG
GTCACAACAACGGTACACTAAAGTCAAGGCTCTGCTTCTCCACTGGAAGTCAGACGATCTGTTTGTTCTGCCAGAACTCG
AAGATCTAGAGAAATGCATGCGGGAAGATTATGGCTACGAGACCGATACCTTCCCCATTCCCTCGGAGAATGCCCATCTC
GAGCTGATGTTGCGGTTGGGCGCCATGATCAAGGACCACGAATCGCCCGATACGCTTTTCGTCGTTTACTACGGTGGACA
TGCACGCATTGACGAGTCCAGGCAGAGTACCTGGTGTGCGTATGTTGTATATTCTCCTCGCCAACTCAAGAGTCTGTCTT
TCTGATGATTTTTACCAGGACGCGGAACCCAAACTCTCCCTGGCTACAGTGCGTTTAAAATTCAGTGTGAACACTCTCCG
TCAGACAGCGCCTATGCTAATCGATGACAGATGGTCTGCTATTCAAACGCTCCTGGAGCGCTCCATGTCGGACACGTTGA
TTCTCTTGGACTGCTGTGCCGGTGCGGCCAGCGCCACTTTCCCCAATGGAAAGAGCATCACCGAAACCATATCTGCGTCC
AGCTGGGATGCCATTGCCCCAGATCCAGGCCGGTATTCTTTTACCAATGCCCTCATCGAGGTGCTACAGGAGTGGCGCAT
ACGCACCTTCTCTGCCGCCATGCTGCATGCCGAGGTTCTCGCAAGGTTAAAACACCCTCGACCCATCACCATCAACGGGA
AGTTGTTTGAGGCGCGCTCTACCCCGGTACATTTCATGATGACTTCGAACCACCGAGCGCCCAGCATTGAGATCGGCCGC
ATGATTCCCAGACGCCAGCAGCTGCCCTCTCCGCCGATGGACGACGCAAACTTGCTACCACCACCCGGAGGACGTGGAGC
CTTGGGTGCCCCAGTGAATGATCCAAACGAAGACACGCCACATGTCATGATTTCGCTGGCTCTAGAGGACGATCAAGATC
TGGATCTCAACGCCTGGGAGCAGTGGCTTGGCAGCTTTCCGGCTCTCGCCAAGTATGTCAAAGTCCAGGGAATTTTCAAG
AGCCACTCAACGCTTCTTCTGTTGTCTGTACCTGTGATGGTTTGGGACCTGCTTCCCGAAAACCGCGCCTGCTCTTTCGT
GGCCTTTATCCGGTCCAACAATCTTCTAAAGGAAAAAGAAAGTGCTGCTCCGGCGACGGTCTCCAATGTACAGAAGGTCG
GTGACGATGGTGCCGCAGCTGAGTTCAATGACGATGTGGTGAGTGAGGACGAAAGCGAAGCCGAAGACGTGGACAAGGAC
ACCGTTTCTGTCATTTCTGGAACCACCTTTACACCAACCGAGGGCCAAGTACCAAGCATCCGCATGAGCATTGCCAGCAC
AACGGTGGCGGGCCTGGAAGATGCTATATCTCGCAGGCCGTCAAGGGTGACGCCGACGCCGCCGATGATCTCGACACAGA
ACTCCTACCGCAGATTTACGGCCACTGATCCACGGTCGACTGTGGAAGCCGAATATTCTAGCTCCCCATCACGCCAGAGC
TTCTTGGGGTTCAGTCAAAACCGCACCACCAAATCATCCCTTGCCAGGCAGAGCGATACGTTCCAGCATCACGATTCTAG
CAATTCGCTGTCAAAGACGATGGTAGTCAATCCGCAAAAAGCAGCACGCCGGACGACATTCGACACTTCCGAAGACTTGC
CTGACAGCCCGATTCTAGCATCGCATGTGGCCGACCGGTTAGAGGAGTATTTCCAGCGCGAGCCGAATCCCAGTGTTGGC
ATCACCGAGTTTTTTGCCTCAAATCTTGGCGTCGAAACAAGAGACATAGATGTGAGTTGCGGTCTGCGCATACTGCCGAA
TTGTTGTGACGGGTGTATTGACTCGGTTGGCAGCTTTGGTTCCATCGCAGGCGACAGCAAGAGTCGACCAGACTCAATCT
CCAAAATCTTAGGATGGACAGCAACCTGGCGTTGGAGAACAGCGGTGGCAGTGGGGCCAAGACGATATTCCCAGGGCACC
TGAATAGACTGCTCGATATATTTCCGCCCAGCCAGTTGCTCTTCGTCGACCTACGATCTCCCACCGACTTTGACAAATCG
CACATTTATGGGGCTGTCAACCTGAGGGTCCCTGCGTCGCTTGTTGAGCAGAGCTACGATCTTCTCAGCTTGGCCTTTAC
CGATGACCAGAGCCGCAGGACCTTTGCAAAGGGACCATCAGCCCGCTGTGTGGTATTTTATGACCGAGTAATCGAGTTTG
CATGGGAGTGTCCAGTCGCCGAAGCTCTTGTTCAGCAGCTGCGCGAAAGTGAGAACTGGAAAGGCGACTTCTACGTTCTA
AAGGGCCATTATCGCGAGTTCTCGTCGTCCTTCGACAAGTACATCGCAGGTGATAGAATGACCCAGGCGGCCAAGGACTA
CGCCGATGGTCTTCGCCAACGATCAGCCCCTTCAGCAGTAAGTTATGCCGGATGTAGGGACGGAAAAAAACTGCTGGCTG
ACATTGTACTCTGCAGTACGAGATAGAGATGATCGAGGAGCGGTACTCCGAGTGGAAGACGCTGGTTGATGATGAGAGCC
GGATGCAGCTCACCGATGCCACAAGCAAGCTGGACGGACGGAGGCAGGCCGTCGAACAGCATCAGGCAGAGCTCGAAGCA
GAGCTGGAGAGCAGGAATCCAGTACTCTACCGCAAAGCTATGGGCCTACGACAGGTGCCCCTGAAAAGCTTACCGGCAAT
TGTTGCACCTTCACATGCCGGGAAAGACCACCGAACAGATCTCGCCGAGCCACTGTCGCGCGGACTACGGAAGATGCAGG
GACATCAATCATACAAGGGAATGCCAGCTGCCTACGACAAGCTAGGCGAGCTTGCAGATGCAACGGCAGCTTCAGGATCG
GACGATTTTGACGAAATTGATCCCCGAGAAGAGCAGTTTCAGGACGACCCAGCTTTTCTGAAAGCCGGCGATTTAGGAGG
CATGGGCATGGGCAGGGGCGACAGCATGGAGTCGAGGCGGGGTCGAGAGCGGTCATTTTGGAAGCGGCTGCGAACAAGTA
AATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62