GenePrediction:GLEAN_1895 Details

Name: GLEAN_1895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1777836..1779572 (+ strand)
Length: 1737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1777836..1779123 (+ strand)
Length: 1288
Type: CDS
Source: GLEAN
Position: GCSC_144:1779202..1779572 (+ strand)
Length: 371
>GLEAN_1895 class=GenePrediction position=GCSC_144:1777836..1779572 (+ strand)
ATGTCTCTCCTCGCCATGTCGGCACCGGCTCTCCCGCACACCTCCTTTCGCCGGGGACTGCCGTGGGACTCGGATACGCG
GGCAGCCGCTTCTGATTTCACCCTCTCGCGCTCGCGGGTCGACCTGGAGCAGATCGCCCTGCCGTCCATCCGCCAGGCCA
TCCCTGAGCTGCAGCTGCGCGTCGCCGACAACCAGCCGTCCGTCTCCGTGGCAAGACCAACATTGGCTCCGTCAGGGCCG
CCGTCCCTGCCGTCTATGCCGTCTCCCAACGCCAACACGTCCGAGTATGTCCACTCGCCCTCTAGCTCCTACAAGCGACA
ACGCGTCTCGGTCCACGACGACCGGTCCGAGAGGTTCAGCCAGGTGCCTCGCCTGTGCGCAGTGCCTCCCCATCTGGAAC
GCCCGGGTCCTCTACAGCGAGCAGCGCCAGCAGGCGCTTCGCCCACCCTGGGGCCTCTCCGCTCAGCTACCTCGGCCTCA
GCTTCGCCTCCGATCTCGTCTGCTTCTTCGGCCACGACCGGCAACACGGTCGATGGGTGGCGCGGCAGTGACTCCCGCTA
TTTGTCGTATGGTCATCGCGAGCCGGAGAGGACGTCAGATCGTCTCCTGGAGACGGCACCTGGTGGCGGCAGCAGCAGCA
GCAGCAGTAGCAGCAACGGCTCCTCCAGCATACGCGGTCTTCCTGGCCTTCCACAGCTTCGTTTCGACCGGGATCCAGCC
CCGATCTCCCAGTTGCGCACGTCTTATCCCGGCGACAGCTACGCTTCGGCTCCCACGGCCAGCAATGACGGCTACCGATA
CCAGCAGCACGGCCAGAGCCCAACTGGTCCATCTAGCAGCGGCGGCCATGGCATCCCCTACGGTCCCCCGAGCTACCAGC
ACCATCCGTCGCGGATGCAGTCTCTCTCTCTCGGATCCATCCGTGGTTTCGACCGAGCAGCGTTTCCCTCGTCCAGCAGC
GGCGGCAACACCGGCAACACCGTCAACAGTAGCGGCAACAGCATGCGGTATGGCGGCCATCATAATGCAACTTCGCCGAC
GGGCTACCATCATGAGTACGTCCCCGTGGGCGAGTGGACCAGCAGCGGAAATGGAGGCTTGACCAGTGGTGTCAGTGGTG
GTGCAACCATCAACGGTGCCGGCGACACGAAGCAGCGCAAGAGACGCGGCAACCTGCCCAAGGAGACGACCGATAAGTTG
CGGGCGTGGTTCGTTGCCCACCTGAACCACCCGTATCCGTCCGAGGACGAGAAGCAGGAGTTGATGCGGCAGACGGGACT
CCAGATGAGTATGTTTGGTCTTTTTTTTTTTTTGGAGGGGGGGGGGCTTTTTCTCGGTTACCTTACAACTACTGACTGTC
CCCTAGACCAAATATCAAATTGGTTTATCAATGCTCGGCGTCGTCAGCTTCCGGCCATGATCAACAATGCCCGTGTCGAA
TCGGACGCGATGCTGTCCAGCCGTGGAAGCAGTGGCAGCCGAAGCGGCGGTGTGACTGAGATTAGCCCACGGAGCTATTC
CGGTGGCAGCAGTCTGCATCACGGCGGCAGCAAGGTGCTGCCCTCGACAGAACATATGCTGTTGTCACCAGAGCGCTCGC
TGGCCCCACGGACATCGGCCCTCTACGGAGCTGTAGCAGCCGAGCACCAGGTCAGCAAGCATGACAGCCCCATGAGCGAA
GACGACTACGACGACCTGTCACGGCACCGCAGCCACATAAAACGGGGCAGCGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62