GenePrediction:GLEAN_1916 Details

Name: GLEAN_1916
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1936034..1937695 (+ strand)
Length: 1662
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1936034..1936237 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_144:1936763..1937002 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_144:1937060..1937695 (+ strand)
Length: 636
>GLEAN_1916 class=GenePrediction position=GCSC_144:1936034..1937695 (+ strand)
ATGCACAGAGTACCGCTTATCGAGACTTACGACGGACGAATAACATTTCTAGATGCTTGCCAGGTGTTCAATGGTACCGG
AGAGGAAATGGCCGGCAATGGGCTGCGCTCCGAGATCCCTGATAACTCTCCTCTAATCTGTGCTATCGACAACTGCCTGA
ATAGCTCGCTTTGGGAAGACAGCGAAGGCGCCGCCCTCGACAATGTAACCCTCAGAGGAAGTGTGTATCAATACGTTGTT
CAACCCTTGGAGGAACATCTGACTATGGGATTCAGTCATATACCTTTGGATGATGTCGATAAGTCTGCAGAAAGTCTGGA
CCTGGATAATTGGTGTCAGGATATGGCCAGCTACGAGTCGACAGGTCATGCTACTATGTTGTCTGTTGAACCATATCACA
ATCCTCCACCGCCACCAAATATGCATTCTGCAGGTGCATATCAGATGCAGGATCTATATCATATTCCGAGTACTGTGCAC
GGTTACAAAGAATCTCAATTCTTCGACGACGAGAATTCTAGCGGAGGTGTATCTGATACTCAGTGAGCTTTTTTCTAATT
TAGCACTCCAGTCCCCGGGATAATGCCATTGCTTACTTCAGATTTCACAGTACTGAGAAATACCGGAAATGGAAAACAGA
ATACCGAGAGGTCTATAAACAGTTCATCACAAAATACCTCTCAGATCTTACAATCGCCTCCTTTCATACAACCTGTAAAA
CCTGTAAAGGTGGCCATCTTGGATACGGGTATCGATCGAGGTCACTACTATATCGAAGCTCATGAAGAAAACCTCAAAGG
AAGGTTCAACTGCTACAACGAGGCACAGAAGAGAAATGTTCAAGATCGAAACGGACATGGCACCTTCACTACGAGTCTAG
TGCTCGCCTATGCTCAGGACGCCGAGATTTACATTGTAAAAGTCGCGGACAGGGAGAATACAAGACCCGATGCCAAGATC
GTTGCAAATGTAAGTGGCTGTTGTTCCTGATATCTCCAAGTCGCTTTCACGAGCTGAAACACAAAGGCTATCAGCCATGC
AGTTGATGAATGGGGAGTGGACATCATATCCATGTCATTCGGGTGGCCCTCTTCAAATTTTGAAGGGCACAGTGTCCTCG
AAGCTGCCATTGATAAGGCATACGGCAAAAAGGTCCTCATGTTTGCCGCCGCCTCTAATAGTGGTGGCCGGCTTGGTCGA
GCGTATCCTGCCAGCAGTACGCATGTCATTTGCGTCCATTCGACCAACACGAATGGGACTAGGTCTGATTTTAGTCCTAC
TGCTGCGCCCAATGCCATTAGCATTGCGACAATCGGCGAATCGGTTGAGTCGGCGTGGCCGGTGTTACTTTGCGGCAAGG
ATGAATCAAACCCAAAAGTTTGTTCAGTCCCGGTCTGGGACATCATATGCGACACCCATTCTTGCGGGCATCGCGGCGTT
TCTATTGCATTACGCACGATTGCATCTGGACAAAGAATCAGCAGACAGACTGAAACGAAAGGACGGAATGGAAGCTCTAC
TGAAGAGGTGTGCAGAGAGGGACCCAATTACTCGCCGAGGGACGGGTATCTATTCGTCGAGCTAAGCTTGAACAGCCACA
ACCTGTTTGGAAACAGCTTGGAGGAAGTGAACTATGAAATTAAGAAAGCGTTGAAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62