GenePrediction:GLEAN_1917 Details

Name: GLEAN_1917
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1946957..1948638 (+ strand)
Length: 1682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1946957..1946973 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_144:1947063..1948638 (+ strand)
Length: 1576
>GLEAN_1917 class=GenePrediction position=GCSC_144:1946957..1948638 (+ strand)
ATGGCCGGAAAGCTTCTGTATGTTCTTTCAAGCAGCCCATCCTTTTTCCTCCGATCCCCGCTGACAAACAGGTCTACCTG
CTACTGCCATTCTTTTTTCTCTCCAGCCTCTCATGGGGCATAACCATGGTGCCACGTGTCAACGTGCTGGTCTCGTTGAT
CTGCCAGCAAATGGTGGACAACGGCACTTTGGGGAGCACACCTATGCCACAACACGAAATGGACATGGGCACCGGATCAG
GAAATCAGCCCGGCTCCGACTATTCTTCCGGCTCTCACAACAGCTCATCCCCCGACTCCAATATCTGCTCCGCTCCCCAA
GTCCTTGCCGGTGTCGCCTTCCTCTCCACTTACCGCGACCTCATCACCGGCATCCTTGGGGCTGTCATGAGCTTTTATCT
TGGTAAGCTCAGCGACCGCATTGGCCGTGTGAAGGTCATGGCTCTCAACGGCCACGGACTTCTCGCCGGCGAGCTCGTCT
TCTTTCTGGTTGTTGCTTTTCCGCGCACTATCGACTACCACTGGCTCTTCCTGTCTTTTGCCGTCGACGGCTTGTCAGGC
TCCTTTCCGCTTCTCATGGCCAGCACGGCTTCGTACGTGGCCGATACAACGACAGATAACGACCGCATCGTCGCCATGGG
CTGGCTGCAGAGCGGCATGTTTCTCGGCATGGCCTTGGGCCCAGCCATCGGCACGGCTCTGAGCCAACTAACGCCCGACC
GACCGGCTGCTGTCTTTCTGTGGGCCATCATTTGCCACATTGTCGGGCTGTTGTGTCTGCTGTTGTTGCCTGAGTCGCGG
AAGGATGTGCATGACGTTCAGATGGCGCCGATCAATCCCGAGTTTGACGAGCTAGACCACAGCACACACAAACATCACGA
CCATCATCACCACATGTATCTGAACCACGCCCGAGGTCACAACCATGGTCACCTTGCCCCCTCTCCCGGACAATCGCTCG
GTTCTTTTCTCCGGTCTACGCTTTCGCTGGCCGCTGTCGATTCCCTCTTCGATTCCAGCTCTGACCACGCTACCGTCCGC
CGACACCGCCGCAACCTCTTTCTCCTACTTGCTGTCACGTCCATCATGTTTGGCTGCTCCGTCGGCAGTATGGACGTGCT
GATGATCTACCCACAGGCGCAGTTTCAGTGGAGCATGATGACGACAGGCAACTTTATCTCGATTGTCAATATTTTCCGGA
CTGTGTCATCGACGCTATTTCTACAGTTATTGATGAAATTCCTTACCAGCAGATTCCGGAGCGCTTTCGCCAAAAAGGCC
AGCCTCAACTCTCAGGTTAGTCCACCAGACTCTCAACTAGCAGAGGCTGCCCAGGCTACCCAGCTCCCCCTTCTTCGGCT
GGCCCTGTTCTCTGATCTGCTGGGCTTCATTGGCTTTGGTTTGGCGCCCTCAGGTTTTTTGTTCACGGCCGCTGGCGTGT
TATCATCGCTCAGTGCATTGAGCGTGTCAGCCACCCAGGCAGCCATGACCATATTGGTGTTGCCGGAGCATGTCGGAAAG
CTGATGGGGCACGGTTGGGTCAGTGCAGGCGCTGACTCGGCTGGTAGCACCGCCGGCTGTGAACCTGGTGTACGGATGGA
CCGTGTCGATGTTGCCGCAGGCTGTATTCTTCGGCTTGGCGGCAGCCACTGGAGCTGGAGTGGTGATGACCTAATTTCTT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62