GenePrediction:GLEAN_1918 Details

Name: GLEAN_1918
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1956988..1957569 (+ strand)
Length: 582
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1956988..1957022 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_144:1957100..1957177 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:1957344..1957569 (+ strand)
Length: 226
>GLEAN_1918 class=GenePrediction position=GCSC_144:1956988..1957569 (+ strand)
ATGGCTATTTTGGAAATCATGCTGCTCGGTGTCTTGTGAGTGGCTTTTTCGTATGTTTTGACGTTTATTTGATCCGAGTT
TGTTAACGATCCTGCAGTGTATGTGCTGCCAGCTGTGTGCGCATCTACTACTTGGCGAAGCTTGTCAAGACTGTCGACAC
CACCGGGGCATTAGGACCGCTGTTCATATGGTTCGTCGTGGAACCAGCCATGGCTATCGTCTCCGCATCTCTCCCACATT
TATTACCTCTCCGCCAGGTTGTCAGCATGAAACTGGGAGGTCATTCCAGCTCTGGAAAAAGCAGTGCCGACTGGTGTGAA
CACAAGAGACTGGCAGGGGGCTGTCGGCGCGAGCAGTGCCTTGTACACATATGGCGGATCGCGGTTCAATGCTGGCAGGG
ACAAAGTGGTCAAGGCCGAAGACGAGATCGAGTTGACCACGCGTGTGGAAGCGGACGCCGGAAAGGTGTCGACGCACTGT
TCGAATTCAGGCGACGACATTAGCACAAGGAATGTCACCAGCAGCCGATGCCAGATTGCTGTCAAATCCTCGATTGTGCA
AGAGTCGGTCGAGCTCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62