GenePrediction:GLEAN_191 Details

Name: GLEAN_191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:120015..122670 (+ strand)
Length: 2656
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:120015..120263 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_167:120356..121025 (+ strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_167:122040..122509 (+ strand)
Length: 470
Type: CDS
Source: GLEAN
Position: GCSC_167:122635..122670 (+ strand)
Length: 36
>GLEAN_191 class=GenePrediction position=GCSC_167:120015..122670 (+ strand)
ATGGCAGTCAGTTCTGTAGACCTGCTTATGGGCTTTTCCAAGCCATCTGAGGATGAAGAGACTTATTACTTTGATGGCCT
TGCGGGCTCACCACGTCTCATCGCCAAGACCTCCACCACTCCCTGGGAGACCCATACAGACATAAACAGTAGGTCGAAAA
GGATCTCGACGGTGGGTGACCACCACCTCGTCCACAAATGGTGCCCAGAGCTGCGCACAGGCATCGTCAGAGCCCTGAGC
AATCCCGGGGTGGGTTGGGATTGCTTCTACCCTATCCGTATTGGTTATGATGAGAACTCCGCCAATGCAGTTGTGTTGCT
TGTCTGCCTACGGGCACCCAGGCAAGGCCCTCATCCATGGGAACCAGCAATGTTGGCGGCGCTGCGGATATGATGATCCA
TGCAGAAGCTTTGGCAGACCCGGACAGTCAAGATGGTTCTGTCACTCTGAATCTCGATGCCAACGGTTTTCTCCAACTTC
ACGGCCGCGATATTCCACCCCAGCCGCCCTTTGCATGCGACGATCGCACATCGCATCTGGTGGCCAAACGCGGCCAAACT
ACGGGCCTCCGATTTGGCATCACTAACGAGATCGAGGCAGTCCGGCGCACTCCATTCGGCAAAGGACAATCTCTTGTCTC
GTATCATCTGTTGGTGTTGGATTTTGTGGGTGGTCACTTTTCTCAGCCGGGTGATTCGGGCTCAAGCGTCTTTGACTGGA
CTGGCCGTGTAATGGGCATATTGGATGGGGGTGAGAGGGTTAAGAACGTGGTGCGCTACATGAAGAAATACCACTTGGAG
ACCGGGGCTGGTCTGCCCGACGTGTCTGATGTGCCGAGTCAAGAGTCGCTCCCGGAGGGTTTCGCACAGCTGACAGCGAG
TGCGATCTTGGGCCTCGATGAGCCAATCGAACCACTAGGGGATGCAATGCCTGGAGAGGACCCGTCGCCAGATGTGACAT
TTGTCACTCCTATCCAGTGGATTTTGGAGGACATACGGGAGTTTGCGGGCTGTGAGCCTGAAATTCTGTGAAGCAGATGA
AGTAATACTTTTGTTATAAAGTATCAGGGATTACCTTTGCAACACAAGAAAGATGTCAGTAATATGCATTCGTCGCTTGT
GAAATCTAATGCCCCTAACAGCCGTCCAAACCTTGGCCGCAGAGAAAGACGTTGCCAGCACCTCTGGTATATTGAGGTTA
GCATTGCTAGTATAGAGGTGCCTGCTGTTTAACTACTGCGCTCCGACGTAGCTGCGAGGATATGCCGTTTGCTGCAGCGT
AGCTGCTGTTTCGTTGTTTTGGAGAAGGCCTGCGCCACCCGGGAGGCTGCGCAGGGTGCAGAAGAAGAGCCTGACAGTAA
CTGGATTCTTGAACTCGTGCTCTGGTTGCACGAAGCTATGTTGCAGTATGCGATTTCACGTGAGGGGTTGAGAGCGCAAT
TACCCCGCCAGGAGCAAGCCCTCCCTCACATTATGTAAGGGCTTTCTTTGTACGACGTAAGGCTCTTTATGCAAATTGTG
CACTGCTGCTTTGTTTGGGGTCCAAAATTCTCGTTCCTACCTTTCAGTTAACGTTTTGTCCCATCAACGATCTTCAACTA
GCGCAACTTTACACAACGAACAGAAATATCGGGACCATGGTGGAATGACCCGCTTCGGCACATGTTGCCACTATCAAATC
ATCCATCTGTCTCGCCATCACTGTCACCGGCACCGGCTGAAGATGAGCTCTTGGCTACAGAAGCAAGCGTGAGAGTGGAC
CGGCTCTACGACGTCAACTACAATTCCGCGAAAATCTTGGAGACTTTTGTAAAGCACCTCGGTGAAAGGGGGAGAAGAGC
CTTGGAAGCAGACATTAGATTCTGCCAAGACGATGCCCAACTAGTAAGACTTGCACGTCACCTCGTCGATGCAATCCTGA
AGCCGTGTGAGTAATCTTCTCCTCTTTTGGTTTTTGCACTTCACCTATTTGTAGTCTATCTGCCATTGTGGTGTCCTAAC
AAACCACCCTCCCAACGCATTACAGTCTTGGTTGCTGGCGGACAAGCTCCGGCACCTTTGCCAACACCCCCAAGTCCCGA
GGCAACTGCCGCAGTCGATCTGGCCATGGCAACTATTGAAACAGCCACCAGGGCAGAGCAGACCCGTCTGCGCAGGGACT
GTCTGCGCAGAGACGGCTACCGCTGCGTTTATAGTGGCTCTTGGGAGATGGATGTTCACGACGACCAGATCGTCCTGCCT
CCTCGCGGTGCTATGAGGACCTCTACCGAATGCGCTCACATCATCCCTTTCGCTTTGGGCTCCTTCAACGAGAATGACGC
TACCGAGACGCGTGACAAGGCCATCATATGGTTCGCGTTGCACCGGTACTTCCCGGCGCTCCGTGAGAAGATTACAGCTA
GAAACATAAATCAACGCGCGAACGCCGTCACCCTCGACTCGAGTGTGCATAAGATCTTTGGCAAGTGCAAGCTTGCTTTT
TCCCCTTCAGACGAGGTAAGTTATAAATGTTTTTTGTATCTTTTTTGTTTCTTACTCATCACGATTATTTCCAAACTAAT
TAATGTATAGGAAAACTGCTACAACACAGCACTATTTTTTGATGATGTGCTGTCCGTCAGTTCAAAGAGCGGTTCTCCAC
TGTTCCGGCTCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62