GenePrediction:GLEAN_1920 Details

Name: GLEAN_1920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1964862..1966823 (+ strand)
Length: 1962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1964862..1964968 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_144:1965128..1966046 (+ strand)
Length: 919
Type: CDS
Source: GLEAN
Position: GCSC_144:1966107..1966823 (+ strand)
Length: 717
>GLEAN_1920 class=GenePrediction position=GCSC_144:1964862..1966823 (+ strand)
ATGTCATCTCCGGTTGCTGCTACTCCCCTCGCCCAGCTGCCCTCAGGGGACTCTCCAGGCGTGCTCCAGACGGTTGTTGG
CATAGAGTCACCCGTAGCGGCCGATCTGTAAGTTTTCCGGGGTATACCCTACGGCCCCTTATCTTCACGATGTGACCAAT
CGCTGATTCGGACCCGTTTGCCAAGGGGACATATTTTGATGCCACAAATCACGGGTATGTGTACTGCCTCCTCGCTTCTC
GTCCGGTTCTTTCCCTAACTCGCCAGGCCGAAATGTCCGCAGCCGTCGGCCGGCAACACGTCGCGCGTCTTCCAGACCTA
CCTGCCCTATCCCGAATTGGCCGAGGCCAAGTTCGACTGCCTGCGTCTGACCATCGTCCGACCCAGCCCAGCGGCTCTTG
CTCGCCATGGTATTGCCCCGGCCGAAGCTTCCCGGTTACCGGTCCTCGTCTGGATCCACGGCGGTGGCCTATCCATGGGC
GCCTCGTCTGATCCCATGTGGGATACTTCTCGGCTCGTGTTGCGCGCTCTGAAAATTGGCAGCCCCATCATGGTCGTCTC
AATCAACTACCGGCTTAACTTATTCGGCTTTGCGGCCTCCCGTGACCTCCTCGTGGCCCAGCAGCAGCAACAGCCTCCTG
TCACCACCGCTGGCCTCAACTTTGGTCTCCGTGACCAGAAACTCGGTCTCGCCTGGATCAGCCGCAACATCGCTGCTTTT
GGCGGCGATCCCGACCGCATCTCTATCAGTGGCCAGTCCGCAGGCTCCGTCTCCGTTCATTCCCACCTCCTCGAGGCCAC
CGCCGCCGCCGCTGCTGGCCGGAAGACACTCTTCCGCCGCGCCATCATGCTATCCGGTGCTCTCAGCACTCTCGGCCCCA
TCCCCTTGGAGCTTGCCGAAGCCCCCTGGAAGCGCATCTGCGACTTGACCCTCGCACCGTCCTCCTCGCCGGCCGATCGC
GTGCGGCACCTCCGCCAGCTGCCCGCATCCACCCTGCTCGAGATTACCGCTACCAACCATATCCAGGGTATTCCCATCGT
AGAGGACGACATCACCGTCTTCCTCGGCCCCTCGGGATCGTCCGATCAGCCTGACATGGACCTTGGCCCTGTCGATCTGC
GGCATGCTCCTCGACAGGCCGCGCAAAAGGGAGTCGATGTGCTTATCGGCTTCACAGACGTCGAGGTGAGCCGTCCCCCT
TGCCACATTCTCCCGTTCACACAACTTATTGACAATATTTCCTAGGCTCTCATCTTTATGGGAGGATTGCCGCCTTTTGC
CCAGATCCTGTCCAAGTTCGAGGCCGTCTACAGCGACCGCAACCATTGTGCCGAGGTTATGAAGGCCTATGGCCTGGTGG
CTTCTGCAACGAGCGCTGAGCTGCAACAAGGCCTTCTCACCCTCTTAAGCGATGCCATGTTTGAAGTTCCAGTACACCTT
GCCCGCAAAAACCTCCAGAAAAAGAGCGGTGGTCCGGCTGTCGGCCAGGTCCAGTCCTTCTTGACTGCTGTTGGCAACCC
ATTTCCTGGGCCGATTGAGGGTTTCGCCCGCCACTGCGTCGAGCTCATCTACCTGTTTGAGACCTGTCACACGACCCTAG
TCGAGGCTGACCGTGGCATCCGGCGGCCATATACCAAGCCTGGACAAGAGAACGCCGCATTGCCGCAGCAAGACCCCACC
ATGAGCAACGGCGAACCGTACAAGCGCTCCAATATAGAGCTGTGCCATGAGTTCCAGGACCACATCATTTGCTACGTCAC
CGCCGACGACTGGAAACCGGCCTGCAGCCCGGACTTCATCATGGTCTATGGCAAGGACCGCAGCACAGAGGTCCAGAGCT
TCACGGACGATCCAGCCTGGAAGCAGCGAGTCCAGCGATGGGAGCTCTTGGCGGAACGTGTCGGCTCCATGATGCAGCTG
GCCGAGGAGGTCCGCGGTCTGTCTGTTTCTGTTGAGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62