GenePrediction:GLEAN_1921 Details

Name: GLEAN_1921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1976762..1979639 (+ strand)
Length: 2878
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1976762..1977098 (+ strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_144:1977166..1977749 (+ strand)
Length: 584
Type: CDS
Source: GLEAN
Position: GCSC_144:1977957..1979639 (+ strand)
Length: 1683
>GLEAN_1921 class=GenePrediction position=GCSC_144:1976762..1979639 (+ strand)
ATGACGGAAGTGCGTGTTCAGCCGTCCTCGTTCGGTCCGCCTGGGCAGACGACCATGATCGAGCCGGCAGCACTGCTGCG
GCTGATGCGCCGACGGGTACCGCCAGAGAAGCGGCAGCGCACCGAGATGAGCTGTGACTGGTGCAAGAAGAAGCGGTGCA
AGTGTCTCAGGGGCAGCACGGCCGACACGTGTCGAGCCTGCAACGAGATTGGCCGGCCCTGCACCACGACGGAGCCACGC
AAGCGGCGGGTGTACAGCAGCATCTCAGCGTCGTCTGGTGCTGGTGGCAGTGTTGACGGTGCCATTGTCGACGGGCCAGC
CCTGGCTGTCGCGCTGTGTGTGGCCCAGCAGCAACAACAGCAACAGCAGACGCTGCAGCTACAGCAGCCAACCCCGGGAC
CCAGTCCGCCGGGAGTCCCTCCACCTCCACGGCTACCAGGCGGCTACGACGAGGACGACGGCCATGTCCGGGTCCATCAC
AGTCGGAGGTGACGACGCGCCCGTCAAGCAGGAGATCACCGTGGCTACAGGACCAGAGCGACGACAACGGCAGCAGCAGC
TCGTAAATCAGACCAGGCGAAGGAGGCGAACAGGCAGAGACACCAAAGCCTCGACAACAACGACCATGAATACATCCACC
GAGATGGCCAACCGTCCACGGGGACACTTGTTTGAGGACGGGCTGGGAACAGCCCGCCACGTCGGCCCAGCCGGCTCACA
CGCGATGCTGTTGAAGCTGCAGGAAGCCATGGCGCCAATACAGACGCAGACGATGTCGACAGCGGGCCTAACAGTAGCAA
GGACTGGCAACGACCTGTCACTTCCGCCGCGTGACGTGGCCGACTCGCTGGTCAGCCTCTTCTTCGATCACGTGCACGAC
GACTGTCCCGTGTTCGAACGGTCGCTCTTCCAGACACGCTACGACGCCATGTGGACAATGCCGGCCACCGAGGCGGCCGA
GCCAGCCTGGTTGATGTGTCTGTGCATGGTCTTTGTGCTGGGGAGCAGAAGCGGCCGCTACAGCAAGAGCATCCGCAACA
GCATCAACATCAGCATCAGCATCGTCTACATCAACATTACGTTCATCCTCCGCATCCTCGTCGCCCATCTCACCCACATC
ATTACCGACAACAGTACCGTCAAGATCGGCCTCGCCATATAGCACCCCCCACCATCCTCCTTCTCGTTCCTTCAGGTCAG
CAACCTCGCCAAGACACGCGAGCTGCTTCCCGACGTGCTCCTTGGCGGACCGACTCTGACACACGTCCAAGCACTGTTGC
TCTACTGCCCCCACCTACACATGACGTGCAGCCGCGACGGTTGCTGGAACTTGACGGGCGTGACCATTCGTATGGCTATG
GCCATAGGCCTACACCGCGACAGCAAGGCCACCTGGTGTAGCAGCCCTGTCGAGTACGAGCTGCGCCGACGCGTTTGGTG
GACGCTACACGCCTTTGAACGGCTCGAGTGTGCATCGCTGGGCCGCACCTCGGCCATTGACGACGCCGATTGCAACGTCG
AGACCAGTGTCCAGGCCGACCTTATGGTCGTCCTAGGGTCTATCTGCAAGCACCAGTATGGCGATGACGAGACTGCTGTC
AGTGGGCTGGTGCCAACTCCGCCGGCCAGCACGTCCTCCCGCTCCCGGAAGTCCCATGTGTCTCACCTCGACTTCGCCGT
CGCCACCACCGAAACCCTCGATCTCTGGCTCGCCAGTCTGCCAGCCCATCTGCGCCTGCACTCGGATCTGTCGCCTTCTT
ACGCTCGTACCATCCTCATGCTGCATATTCAGTACCACTTCACAGTCGTGCTTCTCTACCGGCCATTTCTGCTGGCCCTG
ACGACCACCACAATGCCCGCTGGCACCACGCTGCCGCCCAACCGCCTCCCATCCACCTGGTCCCCCGTCCAGATGTATGC
GCGCAAATGTGTCAACTCGGCCAAGGCAGCTGCCGCTCTGCTGGGCCGCCTCTATGATGCTGGCCTTTTCAACGCCAAGA
CCTGGTGGGACGTCCACTTTGTCGAGGCCGCCTGCATGGTCCTGGTCATGGGTCGCCTCGCCAACGACAGGGACCTGCTC
GCGGACTTCCAGATCGTCGCCGCCCTGCGCTCGTGCACTGACATTTTGCGTGCCTGCAGCGACTTCTCGCCCACGACTCA
GTGCATCGCCATAGCCACGCAGGACATGGCCCAGGCGCTGCTGCTCTGCGCCAGAGAAGGCGAAGGCGAGGTGAAGAACG
AAGCTGCAGAAGACGACGAGGAAGGCGACGACGAGGATGTGGACGAGGAGAACAACTACGACGACAATGACGACGAAGAC
GATGACAGAGAGCGAGATCCAGACTACAAGCAGGACGACAAACAGATGCTGCAGCGCATGCTTCAACAGCAGCTGCAGCA
ACAGCCACACATTCGACAACACCCATCGCCACCCTACGCGCCACCGCTACCTGTTCCACAGACGCTGCCATCACAGTCAC
GACAGTCAGCCCAGCAGTCCCAACCGGTGTCCCTGCCCCAACAGCCGTTTGCACAGCCGACGGTGCTTGCGACCCAGCTC
GCGCTCTCGGACTGCCAGCCACAGCAAGCCTACTACTACTCTGAACAGCAGCACCACCACTACCAGCAGCAGTTGTACCA
AAGCCAGGAGCTCGACGACATGGCCGATATGGCCGACATGACCACCACCGTGTCGTCGGCCGGTAGCCAGTCTAGCAGCA
GCCCGGACCACTCCTACATGACGGCCGTGCCCGGCAACCACATGTACGCCCACGACCTGTCTGGCGACATGTTTCACGAC
CCGTCGATGCCGTGGAACCTGGCGGACATCTCGCAGGCACTGGGCGAGTGGCCGGAGCCGGACCACTGGTGGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62