GenePrediction:GLEAN_1922 Details

Name: GLEAN_1922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1980283..1981346 (+ strand)
Length: 1064
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1980283..1980541 (+ strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_144:1980610..1980753 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_144:1980808..1981109 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_144:1981167..1981346 (+ strand)
Length: 180
>GLEAN_1922 class=GenePrediction position=GCSC_144:1980283..1981346 (+ strand)
ATGTCGGCATCTGACGCAGCCGCAGCAGCCGCCGCGCTGGCTTCCCGCAACGCGACCGAGGCGGCGATCAAGCGAAACCC
GCACGGCGACTTTGGGGCAGTCGAGGCCGGACGGCCAGACTGGGACGCGGCCGCGGCGCCGCACTTCAGCAAGGCGCCGG
CGCCCGGCTGGCAATGGGGCCAGGGCGGCAACGACGGCGGCGCCTCGCTGGCCAAGGCACACGGGCAGAGGCGATCCGCA
CGCACCCGGACGACCGGCCGTGTTCAACTATAAACTGCTCATCTCGGCGGTGATCCCCACGGCCGATCGGACTGCTCAGC
ACGGCAGCGGCTGACGGCAGTGCCGCCAACCTGGCACCCTTCTCGTACACCAACGTGGTCAACCACGACCCGCCCATCTT
CACGATCGGCATCGTTGGCGGACTCGCCAACGCAAAGGACTCGCTGGCCAACCTGGCGGCAACAGGGGAATGTGAGTAGC
GGCAGTGCCGGAAGAAAGCAATGCGGGCTTTGCTGACGTGCCCAGGCGTCCTTAATATCGTCTCCGAGCACTTTATTGAG
GCTGCCAACGCCACGTCGGTCAACGCGCCTTATGGCGTGTCCGAATGGGCCCTGACCGGCCTCCACAAGGCGCCGACGAC
CCATGTCAAGCCGGCGCGGATCCAGGAGGCCATTGTGGCCATCGAGTGCAAGGTAGTCGAGCTCAAGGAGTTTGAGAGCA
GGGCCAACCCCGGCAAGAAGTCCGGCACGCTCATCATTCTCGAAGGCGTCAACTTTTGGGTGCGCGAGGATGCCATCAAC
GAGGAACAGAACTTGATCGATCCAGATGTATGTGTACCTTGCTCTCTCTCTGTCCCTTTATTTCTCGCGTGTCTAACTGG
CTAGGTTCTGCGGCCTGTCGGTCGTCTGGGCGGTATTACATACTCGCGCAACAATGAAGTGTACGAGATGCTCCGGCCAA
CATTCGACTCGGTCAAAAAAGGCGGAGAACGGACAAGAGCTGCTGAAGGAGGCGTCTGCCAAGAACTAGACACGGCATGC
TTCTTCCCGTACAAATTTACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62