GenePrediction:GLEAN_1923 Details

Name: GLEAN_1923
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1984184..1986695 (+ strand)
Length: 2512
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1984184..1984297 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_144:1984356..1984607 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_144:1984687..1985213 (+ strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_144:1985420..1986695 (+ strand)
Length: 1276
>GLEAN_1923 class=GenePrediction position=GCSC_144:1984184..1986695 (+ strand)
ATGCGTCTCGCTCTCCTTTCCGCGCTGGTGGCCTCGGCCGCTGCCACCACGTCGCGTTCGACGCCGCCGAGCGGCAGCAT
CACCGTCTGCAAGTCAGGCTGCAACTACTCCAAGGTCAGTTTGCCCTCTCTGTCCTCACCGCCTCCCGTCGGTCCACTAA
CAGGCCGCTCAGATCCAAAGTGCGGTGAGCTCCATCTCGACCAGCTCGACAGCGGCTCACCAGATCTTCGTCTACGCCGG
CACGTACACGGAGCAGGTCACCATTCCCGCCCTGGCTGGCAAGCTTACCATCTATGGCCAGACCACCGACACGTCGTCGT
ACACGAAGAATGTTGCCAGCCTGGAGTGGGACTCCAGCCTGCTCAGCGGCGCTGCCGATGACGAGCACACGGCCGCCCTG
ATTAACCTGTCCAAGAACGTGGCTGTCTACAACCTGGACATCAAGAACACGTACGGCAAAAGGATCGCAGGCCATTGCCC
TGTCGGCCTACAACACCGAACAGGGCTACTATGGCGTCGGCCTGTTCGGCTACCAGGACACCCTCCTGGCCCAGACTGGA
AACCAGGTGTATGCGTCTTGCTACATCGAGGGCGCTGTCGACTTCATCTTTGGCCAGTATGCCCGCATCTGGGTGACGCA
GTCGCGTCTTGCCGTCACGGCTAGCGGTGGCTCCATCACGGCCAGCGGCCGTGCGGCTTCCTCTGGTGACAGCCTCTTTG
TCATTGACCAGAGCACCATCAACGCGGCTGACTCGAGCACTGCTGCTGCCGGCACCGTCTACCTCGGCCGTCCTTGGGGC
GCGTACGCCCGCGTGGTGTACCAGCTGAACAGCCTGTCGTCCATCATCAACAGCGCCGGCTGGAGCGTCTGGAGCAAGAC
CGACACCCGCACGTCCAACGTGGTCTTCCAGGAGTACCAGAACTCGGGCACGGGTGCCAGCGGCACGCGCTTTTTCGAGA
CCAAGACCAGCGCGCCCGTCACCATTGATACGGTGCTCGGCAGCACCTACGGCAACTGGGTTGACACCACGTACCTGTAA
AGGGTGGCGGTGGGTGTGTGTGTGTGCGTTGTCTGCTCGTCCTCTGTCTTCTTCACTTCTGTCCGGGTAGAGCCCTGTTG
GAGTCTGAGCCAATACCATTTTTCTCTCGTAATGCAAGTGTCGCATCTCGTAGAATGTCACGTGATATGGTCACATGAAC
GGTGACACAAGTATCGCCTACACGACTTGCAAGCAGTCGCGGCCGTGGTAAACGGACCGAATCAAGTAAAGAACTCTGCA
CGCGTCGTGCGTTTGCCAAGCCGGTCTCGAAAGATGAGCCCAGTGATACGGGCAACACGACCATCCACAGCCACATCCAC
CTTGAGCGGGCCTGCAACGGACGACCGACAATCCCGCCTCTGCCCCATCTCCCGCTGCTCAACAAGCTGTACTGCCGGCC
AGCCGACCGTCATGCGTCCTTTCAGCGGTTCCCCCGGCTTCCGATGGAGCTGCAGGACATGGTCTGGCAGCACTGTCTGC
ACGAGATCCGCGTGATCGAACTGTTTGTGCTGCACGTGAGCGACATGTCGCGCGATGGTCCCATCCTGCACGACACCAGC
GAGAGTGAGCACCACCACGTCGTCACGGTCAAGGGCCGCTCGCTGCACAGCAAGATGCTGCGGGTGTGCCGAAACGCGCG
GACGATTGCGCTCCGGTTCTACCGCGTGCACGTGCCCTGCTTCTTCCACGGCAACACGCCGGTCCGCAGCCTCGGACAGG
GCACGCTCTACTTCAACCCCGAACACGACATCATCCACTTCTTCTCGACCTGCAACGAGCAGGCCATCACAGTGCTCCGT
GACCTGCGTGCGAGGGATCCGCAACACGTCGGCTTCCGCACGCTGATCCTCGACCCGCCCTACGTGCAGGCTGCTCTGGT
CGGTGGCCGCGGCCTCGGTGCCCTCCTGCTGCTACTCTACAGCGCCACCATCTTCTGGGACATCAGTGCCACGCTGGTCG
GGCCCACCAGACGCATCACCGAGCCGGGCACCTACGCCCGCATGGGACTGCCAGCTCCGCCCGTCACCGCGTACACAAAT
CTGATCGAGCCGGTGTTGGGTCCCATGGTCGGCCGCTTTCGCATCCTCTCGGAAGACCCGCGTCCGATCGGACCGCTGCT
TCGCCATGCCGACATGATGCACGGCGTGCTCTGGACCGTGAGAGCTGAGTGGGCTGTGCTGCCGTCGAGCGCTACCGACC
CCGCGCTCGCTCGCCGCATCTTCCGCGCCGAGTGCGGCGAGCAGGTCATGTTCGCCCTGCGCGCATCGACCAGACGCGCC
CGCCCCCTCGACACCACGGCCCTGCAGGAGGAGCCGTACGTGCCGGCCGACTTTGAGGCCCCCTGGACTGCACCGCCCCC
CATCGGATTCTGGCTGTTTGCCATTGGCGCCGTCAACATGTTTGGGCCCGACAGCGAGATGCTCAAGCGGTGGCAGCCTT
GGCCGCAGCTGGCTGTCATGCGGCTGCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62