GenePrediction:GLEAN_1924 Details

Name: GLEAN_1924
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1987539..1989464 (+ strand)
Length: 1926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1987539..1987849 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_144:1987912..1988018 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_144:1988089..1988166 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:1988228..1988394 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_144:1988445..1988529 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_144:1988602..1989169 (+ strand)
Length: 568
Type: CDS
Source: GLEAN
Position: GCSC_144:1989398..1989464 (+ strand)
Length: 67
>GLEAN_1924 class=GenePrediction position=GCSC_144:1987539..1989464 (+ strand)
ATGTCTGTCCGAGCACTTCTGGCCTCGGCCCTGCTTGCTGCCGGCAGCATGGCCCAGCTCACGGGCTCCGTCGGCCCGCT
GACGACGTCTGCCCAAAAGGCCGCCGTCAAGGTGTGCAACATTCTTGACTACGGCGGTGTTGCCAGCGTCGACACCGACA
ACGGCGCTGCCATCACGGCCGCCTGGTCTGCCTGTGCCTCGGGTGGCCAGGTCTACATTCCAGCCGGTGACTACGGTCTC
GCCACCTGGGTCTCGCTCAAGCACGGCACCGGTGTCTCGATCAACATCGAGGGCACCATCCACCGCACAGGGTACGTCGA
AGAGTCCCAAGCCCTGTCTTCCCATATCCTCCTGATTCGAACGCGTCCTGCAGCACGGGCGGCGGCAACATGATCTTCAT
CCAGCTCAGCACAGATCTGGAGATCTACAGCGCTACGTCGACGGGTGCCATCCAGGCCCTCGGCTACGAGTTCCACAAAA
GTATGTCGCATCAAGCATCCCATAGCCAGCTTGCTTGCCTTTTTGTCTATTTGCTAACAGTGGCCTGCAGACGGCGAGTA
CGGTGCGCGCATTCTGCGTCTGTACAAGACGTCCAACTTTAGCATCCACGATATCGCCCTTGTCGACTGTAAGTTTGGCC
TTGATCCGCACAAGCAACAAAAGGCATGAATCACCCTAACAGTCTGCAGCTCCCCAGTTCCATCTGACCCTCGATACCTG
CACGAGCGGTGAGGTCTACAACACTGTCATCCACGGCGGCTACGAGGGCGGTCTGGACGGCATCGACGTGTCCGGAAGTA
ACATCTGGATCCACGACGTTGAGGTGTCCAACAAGGACGAGTGTGTCACGGTCAAGGTTAGTTGTCCCGGCTCAGCAGCA
TAAGAGTCCATTGGCTAAACATGCAGAACCCTTCCTCGAACCTCCTGATCGAGTCTGTCCACTGCAACTGGTCTGGTGGC
TGCGGCATGGGCTCTCTGCCGACGGGCACTAGTAAGCCTTTCGTCTTCTTTTTTTTCGCCTGCAATTACAAAAATAATAC
TGACTAATCATTTTTTTCTCTAGACATCCACGACATTGAGTATCGCAACATCTACACGCACCACTCCAACAACATGTACA
TGATCAAGTCGAACGGTGGCGATGGCACGGTCTACAACTTGGCGCTCAACAACTTTATCGGCCACACGAACGCGTACATG
CTGCTGATGGACACGGCCTGGTCCAAGCAGGCCGTCGGCAGCGGCAACGGCGTCGTCTACCACGACATCTCCGTCAACGA
GTGGCACGGAACCGCCCAGAACGGCGTGCAGCGCGCTCCGGTGCGCCTGCTCTGCCCGGCCCTGGCGCCCTGCTACGACG
TCAACATCACCAACTTCTCCGTCTCGAGCGAGGCCGCCTCCAAGGAGCTGTATATCTGCCAGAACGCCTATGGTGAAGGT
GCCTGTCTGAAAGAGCTCGAGGCCGGCGCCACCTCGGCTACCGCCTCGTATGCTGCCACCACCCACCCCCGGACCGTCGC
CAGCCCGGCCTTCGCCACTATGGCCAACGAGCTGGCCAGCGGCTTCGACATCTCCTCGCCCATCCCCATCCCGACCATCC
CGGCCTCCTTCTTCCCCGGAATCGCACCCAAGTCCGCCATCCTGAGCGCTGCCGCCGTCCACGCTGCCGTCGTCAAGACT
ACCAGCACCTCGGCCATTCCCACGGCCACTCCGGCTGCCAGCTCGTCTACCACCTCCGCTGTTGACACTCTGGTCGCCAC
CGTGGTCGCCACCGTGGCCGCCACGGCGTCGGCTGCTTCCACCACTACCGCCACCCCCGTGGCGCCGGTTTTCCCGTTCG
CTCCCATGGGCAGCCTCAGACCGTCTGCGTTCGGCAGCTGGTCCGGCCGCTGGAACACGGGCTTTAAGGGCAAGAAGGCT
GAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62