GenePrediction:GLEAN_1926 Details

Name: GLEAN_1926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1998868..2000716 (+ strand)
Length: 1849
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1998868..1998967 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_144:1999033..1999676 (+ strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_144:1999732..2000329 (+ strand)
Length: 598
Type: CDS
Source: GLEAN
Position: GCSC_144:2000388..2000716 (+ strand)
Length: 329
>GLEAN_1926 class=GenePrediction position=GCSC_144:1998868..2000716 (+ strand)
ATGCCGCACACTTCGCCGTACCCACCGGTACCCATTCCGGAGGTCGACATCTGGACGTTGGTCTTTGAGCGCAAGGCCAA
GGCCTTTACTGACAGCAAAGGTATCCTCTCTGCTGCCATCATTTCTCTTGTATCCCTCCCGTCTTCCCTCCTGACTGTGT
GACAGAGATCATCACGGATGGCGACTCGGACCGCAGCTACTCGTTTGGCGAGCTGCGCAGCGCGGCGCTTGCCTTTGGTC
GGGGCCTACAGGAGCTCTGGGGCTGGAAGCATGGCGACGTGCTGGCCTTTTACACGCCCAACTGCATCGACACGCCGCCG
GCAACATTGGGGCTGTTGTGGGCCGGCGGCATCGCCACGCCGGCGAATCCATTGTACACGGAAAAGGAGCTGACATTCCA
GCTGCGCGACGCCGGTGCCAGTGCCATTGTCACGCAGCTATCCTTTCTCGAGACGGCGCGCCGCGCCGCCAAGGCCGTCG
GCATCCCGGACGAGCGCATTATCTTAGTCGGCGACAAACAGGACCCCTCGGGCACATTCCGGCACTTTAATGACTTTGTC
AGCGTCGGCAGCCCAGGACGCGGCCGTAGCACATCGACCGTTGCCATCGACCCGCGTCGTGACCTCGCCTTTCTCGTCTA
CAGCTCCGGCACCACCGGACTGCCCAAGGGCGTCTGTCTCACGCACCACAACATCGTGGCCAATGTGCTGCAGTTCTGTG
CCATGGACGGCCCTTACTTCCATCCGCATGGAGGCCACGACGGAAAGGGTGATAAGGGACTGGGCGTGTCGCCTTTTTTC
CACATCTACGTGCGTTGTCGATCCTCCAGCCCTGTCTCGTTCTCGTATTCTTCTGACCTTTCAGGGCCTCGTCTGCAACA
TGCTCGTGTTTGTCTATATGGGCTGGCAGCTGGTGGTGATGTCGCGCTTCGACATGGAGCGGGCGTGCCAGCTCATCGAG
AAGCACAAGGTCACGTTCGCATACTTCCCGCCGCCCATCATCCTGGCCTTCTCCAAGCATCCGGTGGTGGACCAATACGA
CGTAACGTCCATTCGGCTCTTCCACTCGGGCGGGGCGCCGCTGACCACGGAGCTCGCCACAGCGCTCTGGGACCGACTGA
AGATTCCGGTCAAGCAGGGCTACGGCCTTTCCGAGACGTCGTCGCTCTCACACATGCAGACGCCAGACGAGTGGGGCAAG
TTTATGGGCTCGGTGGGCAAGCTGGCGCCCAACATGGAGGCCAAGATTGTGGACCCCGACAGCGAGCTCGAGGTGGCCGA
CGGAGAGACGGGCGAGCTCTGGCTCAAGGGGCCCAACGTCTTCACACAGTACCTGAATCTGCCCGAGAACACGCGCGCCA
CCATGTCCTCGTGCGGCTACTTCAAGACGGGAGACATCTTCCGCCGGGACAAGCATGGAAACTACTACTGTGTGGACCGG
CTGAAGGAGTTGATCAAGTACAGTTCGTCTCACGCCCGTTTTGTTCTTGTCTCACAGACATACGCTAACAAACTGTACAG
AGGCTTTCCAGGTAGCACCGGCAGAGCTCGAGGGCGTGCTGCTCGGCCACGACGACATTCTAGACGTCGGCGTCATCGGC
ATCGAAGACCGCGCCCAGGCCACAGAGGTGCCGCGTGCGTACGTGGTGCTTAAGCCGGGTCATGCGCGCAGTGCAGACAA
GGCGGCCGAGATTGTCGCGTGGCCAGCTGGCCATACGGCTCCGCACAAGAAGCTGCGTGGAGGGGTGCACTTTGTCGACA
GCATTCCCAAGTCTGCAAGCGGCAAGATTCTGCGACGTGTTTTACGGGGCCGCGCTCTTGAAAAGGCCGGGTCGGTTGCG
AAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62