GenePrediction:GLEAN_192 Details

Name: GLEAN_192
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:135700..136818 (+ strand)
Length: 1119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:135700..136121 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_167:136209..136818 (+ strand)
Length: 610
>GLEAN_192 class=GenePrediction position=GCSC_167:135700..136818 (+ strand)
ATGCCGTCTGCACGACAAACTCTGGCCGCTACGTCTTTGGTGCGTGCCGCCAGCCGCAGGTCCGGCTGTTTCTGGCGAGC
CTCGACTTTTTCCCTCCCCCACCGAAGCTACTCCTCGTCAGCCGAGCCGCTCGTCGTCGTGTCCGACCTGCCTGCGCCCA
ACTCGGGCCACATCCGAGTGCTTGAGCTGAACCGGCCGGACGCGCGCAACGCCATCTCGCTCGCGCTTCTGGCGGCCCTG
CGCGGCCAGATCGAGGCCGTTGCGGATCAGTATGACGGCGAGGGCAACGAGCTGCCCGCGGCCAGGACCGCCGGACAGGA
TGGCCTGGGGCCTACACGGGCATTGATCCTGGCCAGCGCCGTCGACAGTTGCTTTTGCGCTGGCGCTGACTTGAAAGAGC
GACGGACGTTTACACAGGAGGAGTGAGTTTCAGCGGAGACGTGTTTCTGTTCGACGAACGGTGCAATTGCGTGCGACTCG
TCTGCTCACACTCTATGTCATATCTCCAGAACGAATGCCTTCCTTGCCGACCTGCGCGGCACGCTCTCTGCACTCTCGGT
GCTGCCCATTCCGACAATCGCAGCGGTCTCTTCCGTGGCCCTGGGCGGTGGCTTCGAGCTGGCGCTGTCCACACACATGC
GCGTGTTTTCGAGCAATGCCTTTGTCGGCCTACCCGAGACGCGCCTAGGCATAATACCCGGTGCTGGCGGCACGTACCGT
CTGCCTATGCTGATCGGTGTTGGCCGGGCCCGCGACCTCATCCTGACTGGACGGCGGGTGTCGGCACCTGAGGCATACTT
CTTGGGCATCGCAGACCGGTTGGTCGAGGTCTCTGAGGAGGCTGAGGGCGAGGGTGAAAACAGCGAGAAGGACGAGAAGG
AGAGCCAACAGAAGGTGCTTGAGACGGCCCGCCGGGCGGCGCTCAGCGAGGCCGTGCGACTGGCCGAAGAGATCTGCTCA
GGCGGTCCTGTGGCTGTACGGGCAGCTCTGCAGGCGGTGCAATACCCGACTGAGGCCGTCGAGAACGCAATGTACGACAA
GGTCGTGGCCACGCACGACCGCAACGAGGCGCTGCGGGCCTTTGCCGAGAAGCGGCGGCCGGTATTCCAGGGACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62