GenePrediction:GLEAN_1937 Details

Name: GLEAN_1937
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2103620..2104604 (+ strand)
Length: 985
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2103620..2103664 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:2103930..2104314 (+ strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_144:2104375..2104604 (+ strand)
Length: 230
>GLEAN_1937 class=GenePrediction position=GCSC_144:2103620..2104604 (+ strand)
ATGGCTCGTCGTCCGGCTCGCTGCTACCGGTACTGCAAGAACAAGGTGCGTTTTTGACAGGAGAAGGGGAAAGGGGAAGT
TGGGGGCAGAAACCAGAGAAGAAGCGGACGAAGACGAGGCAATTGGAAAATTCAGGGCGAAGGAAAGTAGCGAAAACGCC
CTCGTCACCTATCGTCTTTTCGCCGAAATCTTTGCCCGGAGTACTCGGAAGAGTCCAAGGGTCTCTGCTTCGTCTGCTTC
TCTCGGCCCCAGAACCGAAGAGTGGGAGGATTACAATGAACGGGTCACAGATGCTAACTTCAGCCCTCAGCCGTACCCGA
AGTCCCGCTTCAACCGTGGTGTGCCCGACCCGAAGGTCCGCATCTTCGATCTGGGCCGCAAGCGTGCCACCGTCGACGAC
TTCCCGCTGTGCATCCACCTCGTCTCCAACGAGTATGAGCAGCTGAGCTCCGAGGCCCTCGAGGCCGCCCGTATTTGCGC
CAACAAGTACCTCGTCAAGTTCGCCGGCAAGGAGGGTTTCCACATGCGCATCCGCGCCCACCCGTACCACGTCGTCCGCA
TCAACAAGATGTTGTCGTGCGCTGGTGCCGATCGTCTGCAGACGGGTATGCGCGGCGCCTGGGGCAAGCCCAACGGCACC
GTCGCTCGTGTCAACATTGGCCAGATCATCCTGAGCGTGCGCACGCGCGATTCTAGTGCGTATCTACTTCCGAGTATCAA
CACTGCATCTGGCAGCGTTTGCTAACAGCCGACAGACCGCGCCATCGCTCTTGAGGCTCTCCGCCGCTCGCAGTACAAGT
TCCCCGGCCGGCAGAAGATCATCGTCTCCAAGAACTGGGGCTTCACCCCCCTGCGTCGCGAGGAGTACCAGGAGAAGAAG
GCCGCCGGCCGCGTCCGTGTCGACGGTGCCTACGTGCAGTTCCTGAGCAACCACGGCAAGCTGGCCCAGAACGTCAAGCA
GTTCCCCGACGCTTTCTCCTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62