GenePrediction:GLEAN_193 Details

Name: GLEAN_193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:139654..141302 (+ strand)
Length: 1649
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:139654..140513 (+ strand)
Length: 860
Type: CDS
Source: GLEAN
Position: GCSC_167:140606..140720 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_167:140775..141302 (+ strand)
Length: 528
>GLEAN_193 class=GenePrediction position=GCSC_167:139654..141302 (+ strand)
ATGGCGTCCTCGCAAGACCTTCCGCACATGAGCTTCCGGGCTTTCGTCGACGAGCTTCGTGCCGACGGCGATATTGTCGA
GATCAACGACGAATGCGATGCCGATCTCGAGGTGGGCGCCATCATTCGTCTCGCCTGCGAGACCGATGCCAAGGCCCCCC
TGTTCAACAAGCTCAAGGGCATGGACGGCAACGGGCTATGGCGCATCCTGGGCGCGCCCAACTCGCTACGTGCAGACCCT
GCCCAGCGGTTCGGCCGGCTGGCTCGCCACATCAACCTGCCGCCGACTGCGTCGATGAAGGAGATCCTCGACAAGATGGG
CGCTGCCAAGAGCACCCCACCGATTCCGCCCAAGACCGTGCCTACCGGCTCCTGCAAGGAGGTCAAGCTGACGCCCGACC
AGTTCGACCTCACCACCCTGCCCTCGCCCCAGCTGCACAAGTCTGACGGCGGCAAGTACGTGCAGACGTACGGCATGCAC
ATTGTCCAGACGCCGGACGGCAAGTGGACCAACTGGTCTATCGCCCGTGCTATGGTGCACGACCGCAATCACCTGGTCGG
CCTGGTCATCCCGCCCCAGCACATCTGGAAGGTCCAGCAGGAGTGGAAGAAGATCGGCAAGGACATGCCGTGGGCCCTTG
TCTTCGGCGTGCCTCCTGCTGCTATCATGGCTGCCAGCATGCCGCTACCTGACGGTCTGTCTGAGGCCGAGTACATTGGC
TCGCTCGTCGGCACCGCCCTGGAGGTTACCAAGTGCGACACCAACGACCTGCTGGTCCCGGCCAACTCCGAGATCGTCTT
TGAGGGTTTCATGTCCTCCACCGAGACCGCACCAGAGGGTCCTTTTGGCGAGATGCACGGGTAAGCCCCTTTTCTCTTTT
CTATTTCATTTTTCCTTTCTTCTTATTCTGTTTCTTCCCCCTTAAGTTATTGCTTCCTGCTAACCTAGACAGATATGTGT
TCCCCGGCGATGCTCACCCACAGCCGCTGTACACGGTAAATATGATTACCCACCGCAAGGATGCCATTCTGCCCGTGAGC
AACTGCGGCCGTTTGACAGATGAGACGGTAAGTAAATGCTAATAACACATACTATATGCCTATCTTTACTAATACGACCA
GCACACAATGATTGGTCCATTGGTGGCCGTCGAAATCAACGTTATGCTCAAGGCAGCTGGCCTGCCCATCACAGACGCCT
ACACCCCCTTCGAGTCACAGGTCACGTGGTGTGCCGTCAAAGTCGACACGGCTAAGCTGCGGGAGCTCAAGACGACCCCC
AAGGAGTTCTGCCGCAAAATCGGTGACTTGATCTTCAACACCAAGGTCGGCAGCACGATCCACCGCATTGCCGTCGTCGG
TGACGACATTGACATCTTCAACTTCAAGGATGTCATCTGGGCCTTCTGCACGCGTTGTCGCCCTGGCATGGACGAGTATT
TGTTCGAGGACGTGCCTGGCTTCCCGCTGATCCCCTACATGAGCCACGGCAACGGCCCCGCGAACCGTGGCGGCAAGGTC
GTCTCCGACTGCCTGTTGCCGAAGGAATATACCACCGGAAAGAATTGGGAGGCTGCTAGTTTCAAGGAGTCCATCCCCGA
GAGCGTGCAGGCAAAGGTGCTGGGCAACTGGAAGGCCTGGGGCTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62