GenePrediction:GLEAN_1942 Details

Name: GLEAN_1942
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2119437..2121289 (+ strand)
Length: 1853
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2119437..2119615 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_144:2119746..2120548 (+ strand)
Length: 803
Type: CDS
Source: GLEAN
Position: GCSC_144:2120610..2121289 (+ strand)
Length: 680
>GLEAN_1942 class=GenePrediction position=GCSC_144:2119437..2121289 (+ strand)
ATGCTGCGCCCGCAGGACTGGACCAGCCGAAGGCTTGGCAGACGCGCAGAGGACGGGCGCATACGACATGCGACGCTGGC
AGCTGGCAGGATGGCCGTCTCGGCGAAATGCAGCGGCCTCTGGACGTTCTGTCCTCTGTCAGCTCTGGCCGACTGGCGTC
TGATCGGACTGTTCTCTCAGTCCGATCGTATTGCAGACAGCACCAAGACCGGCGAGCACATATTGCCAGGGGCAGCCCAT
GGCAGCGGGCTGGCGACTGGTGGCAGAGCCATGACGGACGAGCTGGCAACCAATGCGATCTTTCCCCAGCCTATTTGCGG
CGTACGACATGGCCACACACAAGACGGGCGATGATGCTGAGCTGTCGGACAGCGTGGAGATGGCAGCAGCAGCAGCAGCA
GATGGACAGCAGCAGCGGACCTGGCGACAGCGGGTGTTGGCGGTGGTATGGGACTCTCTGGACAAACCGGCAGTGGAGCG
GCGATTGGTAGCGAAGCTGGACTGGATTCTGCTGAGCTATGTTTGTTTGGCATACTTTGTCAAGTACCTGGACCAGACGA
ACGTGGCGAACGCGTACGTGTCGGGGATGAAGGAGGAGCTGGGGCTGGGCGGCAACGACCTGAACCTGCTGACGACAGTG
TGGACGGCAGGCTACGTGGTCGGACAGGTGCCGTCGCAGCTGGTGATGACACGGGTTCCAGCACGGCTCTGGTTGCCGGC
GCTGGAGCTGGGCTGGAGCGCGGGGACGGCGGCGGTGGCGGGAGCACGTGACCGGCACGTGATCTTAGGTTTGCGGTTTG
TGATCGGGTTGCTGGAGGCGTCGGCGTACCCGGGCGTGATGACGCTGCTGGGAAGCTGGTACCGACCGGAGGAGCTTGCC
AAGCGGGCCTGTCTGTTCCAGGCGTCGAGCAGCGTGGCCCAGATGGTGGGTGGCTACGTGCAGGCCGGCCTGTATGCGCA
TTTGGACGGCGCGAGAGGGCTGGCGGCCTGGCGCTGGCTCTTTGTGCTGGACGGGTTGCTGGGCCTTCCGGTGGCGCTGT
ACGGCTTTGTGGCCGTGCCGGACAGCCCGTCGACGACGCGGGCATACTGGCTGCGGCCGGCCGAGCGGGCGTGTGCCGTT
GAGCGGATGGCTTTTCAGGGCAAGCGGCCAACCAGGGGGACTGGCACGAGCAGCCACGCTGCAGTCGCTCGCCAACCTCT
TCCGCGAGTGGCCCGTCTACCTTTTCACGGCCTCGTTTGTGTGCTACATCCAGGCGACGCGCGTGTATGCGTACTTTGGG
GTCTGGCTCAAGGCGACGCACCGCTTCAGCGTGGAGCAGGTCAACGAGATTCCGACGGCCGGCTTCGGTTTTCTGGTGGT
CTGCACGCTGCTGGCGGCCTGGACCAGCGACGGACTGCAGGCACGATGGCCGGTTGTGGTGGCGCTCGCGTCGGTCTCGT
TCGTCGGTGCGGTCGTGCTCGCGGTGTCGGTGCATCGGCCGGCCGACAGCCAGAATTGGGGGGCGGTCGTGGCCGGGTTT
CTGCTGACGTACGTGACGACGGCATCGGCCGGCATCTACATGGCGTACATGAGCGAGGTGTTTGCCTACAACGGGCTGCA
CCGGGCCGTGGCCATTGCGCTCGCCGACACGGTGGCATACGTGTTTGTGGCCTGGCTGCCGCTTGTCGTCTTCGACGCGG
CCGAGGCGCCGTACTTTGCCGTTGGCTACACGGTCACGGCCGTGTTCCTCGTGCTGCAGATCGGCACGATCCTGCTGGTG
CCGGTGGCGCGACGGCGCTGGCCCGTGGGCCAATACGAGGAGGGCTGTGCAGACTCGGAGGCGGTGGTGGTGCATTCCAA
GACGACTGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62