GenePrediction:GLEAN_1943 Details

Name: GLEAN_1943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2121549..2124171 (+ strand)
Length: 2623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2121549..2121657 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_144:2121893..2124171 (+ strand)
Length: 2279
>GLEAN_1943 class=GenePrediction position=GCSC_144:2121549..2124171 (+ strand)
ATGACAGGCGCATTGCTACAGGCCGTGCCTGCTGTATCCGGCAGCGGCGATTGCACTATTGCCATTGATGCGATCCTGTC
GTCTTTCCCAAATCCTGGCTTCTTCCACTGTAAGACGTGTGGATCGAGACGGCAGAAGCCAAAGCACGCACGTGAACAGG
ACGCTGTCCGCTGCAGATCGAGAGGCAGCAGGATGGTGGGCGGTGGTCACACCTGTTCTGTCTGTTCTCTGCGCCTCTCT
TTCTCGCCTCTCTCGCCTCTTTCTCCTCTCTCTCCTCCATCTCTCTTCATCTCCTCTCTTTCTTCTCCCCCTCTTTCCAC
CCCCCTCACCCCACAATGAACAAGGCCAACGCGGGCTCATTGGCATCGCTTCCGCGTGGAAAAAGCCACAGCCGATTCGC
CGGTCGCTCTCGGCAGCCATATCCGGAGATGGCCACGACGACAAGGTCGGCCAGCCAGACGAACAGAGCACCCTCAACGG
CACCAGCACGCGGCTGACTACGGCCATGTATGCCTGTCTGCGCTGCCGGCACTCGAAGAAGCGGTGCGACCGACAGCTGC
CCATCTGCACAGCCTGTCATCGACTGGGCGCCAACTGCCACTTCCCGTCTCCGGCAGCCGGCAACGCCTCGCAGACGGCA
GCGCTGCGGGCCCGCGTGCAGTGGCTGTCTGCCTTTGTCGACTCGCTGCTGCCGCCTGGCTCGGCTCCAGTGTCTTGCTA
CGACACCGGCATCGACCTGCATGCCGCCATCGGCATCGTCTCACGGCCGTCGCCACTGACGCCATCCGAAAGCAGCAGCA
CCACCTCGACCACTACGGCCATGGCTGCCGGCAGCAGCGGAAGCACAGCCACAACACCTGCCACACCACTAGCCTCAGCC
TCAGCCTCTGCCACTTCATCTCTGATGGGCATCACCACAACTATCCCTCCGGCCAGCCGGCTGCCACCTCCACAGCTGCA
GCTTCCGCTACCCCCGGCTCTGCAGCTCGCACTGTCGCCTCCACCGCCACCATCAGCACCAGCATCCGGCCCATCATCAC
GTTACTTGTTGGGCGAGACGTCGCCGCTGCTGCGTGCACCACCTCGGCCTCGGCTGCCGGCTGTGCGGACGTTTGCGCAG
AACATTGGCGTGGACGGCATGGCGGCGGTGCGGTCATACTTCCGGCACATGCACCGGTCGTACCCGTTCCTGTACGAGGC
GCAGATCGTCGAGGACGCGGGCTCGAGTGCCGGCCGAGCTCTGTACGCCGACGGTGGCGAGCTGACGCCAACGTTGGCTC
GACTCTATCTAGTGATGGCAGTGGGCGTGGAGGCCGTGTGGCGATTCAACCGGCCGGCAGTGGACGCGCCGATCCCGGTG
ATCCCGGTGCCGTATCAAGACGTGGTGCAGTTGTGTCTGGGAGGCACGCGCAGCGTGGTGACGGTGGAGGTGCTGCTGCT
GCTGGCGCTGTGTTCGCTATTCGAACCGGAACGTTGGTCGTCGCCGTGGACGTTGATGGGGATTCTGGCGCGCGAGGCCG
TGATGCTGACGCTGAACCGGCGAGCCGAGCCAAACTCGCGATCGGGACCGGCTCCAGGCTCGAGCTCGGGGTTGACGCTG
CAGGCGATGGGGTTTCGTCACCGACTGTTCTGGTGCATCTTCTCGCTGGACCGACTGGTGGCTGGCGTGTTTGGGCTGCC
GCTGGCCGTGCAGGACTATGACGGCAATCTGCCGCTGCCAGGCGTCACGACCGAGGAGTTTGCCGCATCTGACCAGGCCC
AACACATTGCCACGCTGCAGATTGCGCGCCAGGCCATTGCTCTGCGTCTCATCGAGGGCCGCTGTCTGGAGCTGGTGCAC
CTCAACAGCACCGGGGCGCAGACGAAGTTGCCGAGCATGCGGGAGCGCCGGGCTCTCGTCGACGAGCTCCGGGCCGCTGC
CGACAACTGGTACACGCAGGGCTGTCTGCTGGCCCGACGTGAAGCCCGGGCTGCCCACTTCCATAATACCATCACCTGGC
TCAACACCAACTACCACGGCATTCTGCTGATGCTCTACTGTCCGTCACTCTTCAACGACGGCGCTGCTGCTGTCCGGCCC
GACGACCTGCTCGATCTGCACCGCACCCTGCGCATGTACACCCAGAGCGTGCACGCCCAGTATGCCGACCGCCAGCTGGC
CCTCAACTGGACCACGCTCAGCCGCATGCTCGTCGTCTGTCGCATGCTGCTGCACTGCCACTTTGCCTGTTGTGGGGGCA
CCCCAGGTCCTGGGAGTCCTCGTCACGTCATCATCCTCGGTGAGCAGCTCGACATGGCCCTGCAGTGCCAGGAGTGCCTC
TCGGCCTTTCACGTCTCGTGGGTCTATGCCCGCCAGAGCCGCCACGTCTACCATCGGCTGATTGCCGTCCTGCGTCGCCG
TCTGCAGATCGAGGAGACTCGCGCCAGCCATGGACCACTGGGAGCACTGGGAGCACTGGACGGGCTGCCGGTCTCGTCCA
CGGAACCCAGTCCCGACGTTGACGATATCCACAACATCTGCGACGAGGCTGAGCGGCTGATCCGCGACGCTCTCGGCCGG
TCCAGCTGCTACACCTACATGGAGGGCGAGCCGCGGCAGCGGGCGATGTGGAATGACGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62