GenePrediction:GLEAN_1944 Details

Name: GLEAN_1944
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2131412..2133975 (+ strand)
Length: 2564
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2131412..2131572 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_144:2131636..2132331 (+ strand)
Length: 696
Type: CDS
Source: GLEAN
Position: GCSC_144:2132397..2133975 (+ strand)
Length: 1579
>GLEAN_1944 class=GenePrediction position=GCSC_144:2131412..2133975 (+ strand)
ATGGCGGCTAAAGACGATTTGAACGGGTCGTCCAAATTCGCAGAAAGTGCCGTTAACTTGATTTCGCGGAAAAGCAACGG
CCAGACTCTGCCGTCGCGGCGCCAATCCATTCCCAAGAACCAGCCAAGTCTCATCGGCCGTCTCTTCAGCACAGCTGCAA
GGTATGGCTGCTCTTTTTTGCTGTCAGTCCTTCTGCCATATCATTAACGACTTCTTCTCTGCAGACTCTTGACATGGTAC
TCCATTATCACCATTCTCTTCCGCTGTCCTGCGTCTCTCGACGCCTGCGACGAAGCATCGCCACGGATATGCAAGCCCTA
CTTTGAGGCCAAGCTGGCCGTTGAGCCCTTTGTTCGGCCGTACTACGATGTCTATGCGGCCCCGTACGTTGAAGTCGTCC
GGCCCTATTACGACACGGTCGACCGCATGGTCATCGGGCCCGCCCGCCAGTATGCGGTCAAGTATGGCGCACCGCGGGCA
GAGCAGCTGAAGCTGCTTACTCGGTCCCAATGGGATAAGAACGTCCAGCCGCAGCTGGCAAAGGCCCAGGGCGTTGCCGC
AGAGAAGTACGCAGTGCTCCTTGGTCCTCACGTCGATGGAGCGGTTGCGGTTGTGCGTCCCTACGTCGCCATTGCTCGTC
AAAGCGCTCTGCAGACGCACGAGGATGTTATCTTGCCCTCCTTCCGCTTTGTCGCCCCGTACGCGCTGCAGGGCTACGCA
GCCGGCTCGTCATTTGTGACCGGAACTGCCGTGCCGACGGCTATCTGGACTTGGCGCAGGGTCGCCGCTTTTCTGGATGG
TGCCGTTTGGCCACGGCTGCAGCTCCTCTACATCGACACCGTTGAGCCGCAGCTGGCCAAGATCGGACAGCGGCTCGGCC
GCTACAGCGACAAAGGCCAGGGGACGAAGCAGAAGACATCGTGAGCATGAACAGCTGTTGTGGTGAGCGTTTGTTTTCAT
TGCAGTTAACCGTCTCCTTTGGCAGCATCCAGAGCATAGCCCCGTCCTCCTTCACGAAGCCGACGTCGCCCGGCAGTTCC
TCCAAGACAACGGCATCGTCTGTGGTGGCCGAGGAGACCACAACCACGACCACGACAACAGATGCCGGGGTTTCATCCAC
TGGTCCAACTGCCACGCTGCCCCCTCCAGCTGTCACCGCGGCTGCCAAACTGCAATCCCATGCGCCCATCCAGCCGCCAG
ATGAGCCGGAGCAGGGTGAGAACGACGAGCGCCGGATCGCCCGCGAGACGGTGGCCGAGGACCTGCGGGCGTGGCAGGAG
AAGTATGCCAAGGCAGCCGATGAGGGCGCAGCCGAGATCGAGCTGCGGGTCGAAGAGATCGCCACGCGCATGATCCGCCG
GCAAGCGCGGATCACGGGCAAGTCGCTGGTGGTGCAGCTGGAGAAGGCAGTCGAGACGCAGCTGGCGCAGCTGCAGCAGG
AAATTGTCGATGTGGTCGGCGCCGTAGCCGAGGTCAAGGCGGCGAAAGCTGAGGCCGATGAGCAGATCCTGGCAGCGGTG
CGGCGGACGGGCGTGGAGATCAAGCAAAAGGCGCAGGCGGTGCGGTCGTGGCGCGACGAGTTCAGCAAGGAGCTCGAGCA
GACGGTCAACCGGGCGGCCGAGAACCACTTCACCATCCTGGGGTCGATCCGTGACCTGGCGCTGCAGAAAATTGGCATGA
AATGGGCCTGGATGGAGGGTGTGACATATCGCGACTGGGCCAAGTACCACCAACTGAAGGGCCGGTTCGACGAGTGGGAG
AACGACCTGGAGCAGCTGATCGTCACGCACCCGGCGCTTGAGGAGGCCCAGAACGCCGCCCAGGCGGTCGAGGACGAGGC
CATGCTCACGGCACAGTCAGCGGCCAAGGAGCCCGCCCGGCTCAAGCAAGTCGCCCCCGGGAAGGTCGCCGCGCTGGATG
CCAGCGACAGCTTTGACAGCGACGCGACCAAGGCTGCTGCCGAGGCTGCCGAAGCCGCCGCGGTTGCTGGGGTTGCTGAG
CCGGAGGCGGTTGCTGAAGCTGAGGCTGGGGCCGAGACAGTTGAGGCCGAGATTGTCGAGACAGATGATACAGAGACGTC
GACTGCCACTACAGCCACTGAGACAGAGACACAGAGTGCCGAGGAAACTGTAGGCGTCTCGGAACCAATTGACGATGCAG
ACATCATCGACATCCCAGCCTCCTCGTCGGTAGCCCCGGCCTCCACGGTGTCTGCTGCAGAGGAGACGCCAACAGAGGTA
GTGGAATTTGAGAAAACCCCTGCAGAGGAGGATGTCGTCGAGGCACCAGCGCCCACAGCTGAGGCGGGCAATCGGGAGGC
CCCGGAAAGCGAGCTTCCTGTCGACAACACCCTCACGGCTGTTCTTGGGGACGTGACAATCCTGCCGGTGGCTGAGAGCT
CCGATGCCGAGGCTGTGGCAGTGGAAACCGCTACTCCCGAGATCGAGGAGCCTGTCACATCTGCCGTTGAGGACGATGAG
ACAACAAACACCACGTCAAGCACTATGGCCGAGAACAGCACTGCTTCTACAGCCGCGCCGTCAGACATCCCCAGTGAACT
GTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62