GenePrediction:GLEAN_1946 Details

Name: GLEAN_1946
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2137257..2139928 (+ strand)
Length: 2672
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2137257..2137344 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_144:2138077..2139480 (+ strand)
Length: 1404
Type: CDS
Source: GLEAN
Position: GCSC_144:2139533..2139738 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_144:2139794..2139928 (+ strand)
Length: 135
>GLEAN_1946 class=GenePrediction position=GCSC_144:2137257..2139928 (+ strand)
ATGTCAGCGGACCAAGCTGGATCCGGCGACGAGGGTCTTCCAGCCGGCAGCAGCAGACAGCACAAAAGGTCGCGGGTGCT
GCTAAGTTGTGCGCCCTGTCGAGTGTCGAAGCTGAAATGTGACCGATACACGCCGTGCGGGAACTGTCTCAAGAAGGGCC
CGCACAGATCTCTGCACCTATGTACCGCGGCCGAAGAAGCCAGAGAGGCAGGCCACCAGCATGGCAGCACGACTGCGTCG
TCTGGAAGGGATGCTGCGGGAAATGATTCCCGACGATGGCTCAGCAGCCATGTCCAGCTTTGGTGAGGCGCGCAATGTAG
ACCAGGCGGCCCGTGTCACGCTGGAGCAGAAGCTGGCTGCCGAGGGGATCACACTGGCAACAGCAGAAGAGGCATCGGCA
GGAACAGGACCGGAAGTCGGTGCAAGACCGTCACAGACAGACAGCAAGCCGAGCAGGCTCGATGCAGGACGTGTGGTGAT
GGGTGAGCGGTCGACGACATACGTTGGGGCGACGCATTTCATGGCGATGCTCGACGATATCGAGGACCTGAAGAGCTACT
TTGAAGATACGCAGAACGCCGAGGCCGAGACAGAGCCAGACGAGCCGCTGACGGACGAACTCGCCGGCATCGGTAATGCT
GGGGACGAAACGAGTGAGGTCCAAGCACGATCTGCTGGCAGTGATGCCGGATCGAAGCGTGGTGGACCGGCTGATTGTGT
GCTATTTTGGGTCCAACACGCCCTCGCTGTGTGAGTGTGCGATGTGGATTGCTGAGGGCTGATGGGCGTGAGTGAAAACG
AAACAGCTGACGACAGACAGACACGGTGCACCGACCGACCTTTGCCAAGGAGTACAGCGCGTTCTGGCAGGATCCGTCAG
CAGCCTCGGTCGACTGGCTGGGAGTGCTGTACGGGATCCTGGCGCTGGGGGTGCACTTTGCCTCACTGCAGGGGCCCGGG
AGCACGGCACTGGAGGTCACGGCGATCTCGCTAAGCGAGCAGTTCCGGCTGTACCGATCGGCGACATCGTGGGCGCTGAC
GACGTCGCGGCTGGTGAGCCCGAGCCAGCAGACGATACAGGCGCTGCTCATGTACGAAGAGGCGGAATTCCTGGTTAACC
GGGCCAGCCAGACTCATTGCTGGCTGTTGTCGGCCACGTGCATCCGGCTGATGCTCAACATGGGAATGCATCGCGACCCG
AGCAAGCTGCCGACGATCTCGGCCTTTGACGGCGAGATGCGACGCCGGATGTGGAATCTGGCCATCCAGCTGGACCTGAT
CGTGTCGTTTCACATGGGTCTTCCGAGCATGATCCACGGCATCCCCAGCGACACCGGGCTGCCACACAATTTGCTGGACG
AGGACTTTGGCGAGGACTGTGCCGTTTTGCCGCCATCGCGACCCGGCCACGAGTACACGCCGATGAGCTATCCGATCTTC
AAGAGCATGGTCTGTCGCGTGTTCGGTCAGGTTGCCCGGCTGTCCCACACGCTCATCCCGCCATCGTATGCCGAGGTCAT
GCGCACCGACAGTTTGCTGCTCGACCGTTGGCGCCAGATCCCCTCCTTCATGAAGGTCTGCCCGCTCGCCGACGCTGTCT
TCGACCCACCCTCGCTCATCATCCAGCGCTATGGCCTCGCCTCGCTCTTCCAGAAGAGCCGCTGCGTCCTGCACCGACCC
TATCTCGCCGTCGCCGTCCCCCGTCCTGAACACGCCTACTCACGTCGCACTTGTCTGCAGGCTGCTCTCGAGCTGCTCGG
CTACCACGAGGCCGTCGCCGAGGCCACTGCTCCCGGTGGCATCCTCAGCCACGTCGGTTGGTTCGTCACCGGCCTCGGCA
TGCACGACTTTCTGCTGGCCGCTATGATCGTCTACCTGGTCGTCCAGAACGACGCCCTATTCAAAGACGAGCTGATCATC
TCCGACAGCGCCAGCGACTCGGCTTCTGAGCCTCAGTCGGCCTCCTCGTCCTCGCCGCCAGCCCTGCCGGCTGTCAGGAG
CACGCTCGTCAACCTTCTCCTGCGCTCATACCGTCTCTGGGCCTCCCTGGCAACGAACCACTACGAGGTCCAAAAGGCGG
CCGAGCTGCTCAGGATCATGGTCAACAAGATTGACGCCCACGTCGACTCGACCGGACATCCAACATCCACTGCTTTTGAT
ACTGGCAGCTCCTGGCAGATGGGCATTGACGAATCCTCTATATCGAACGTCTCACTGGGCGATGGTAGGACTTCTCTCGC
CAACGTATCTAAGCAGCTGCTAAAAAACAAGACAAGAACCCATAAGCATGCCGCCATCGGTCTCCTATGATCTCCCTTTC
GACCTTTCCACGCCCGTCTTGAACCAAGACAGTATGCAGGCCAACTTCTCGCGCCAAGACTTGGTGCCCAACGTAGCGGC
TGTCAACAATGACGGAGATCCGCCAGTGATGCCGGACATGTACGAGTCGTGGATCACCATGCCTCTCGAAACGCTCGACT
GGGTACGTGTGCTGTCATCCTATTTATTGAAATTGGCCCATCTGACCCTCATGGCAGGACACCGTCGACAACGGGCTCCG
GGCCAGCAGCAGCCACAGAAACGATTGGATCGACCAGTCGACATTAGACGACATCAACAGCATCTCTACTGGCCTGTGGG
ACCATCCGGATGGCGTGCTCCAAGGCCCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62