GenePrediction:GLEAN_194 Details

Name: GLEAN_194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:148784..150771 (+ strand)
Length: 1988
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:148784..149137 (+ strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_167:149187..149261 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_167:149305..149338 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_167:149399..150771 (+ strand)
Length: 1373
>GLEAN_194 class=GenePrediction position=GCSC_167:148784..150771 (+ strand)
ATGGGCGAAATCGAGCTGGAAAAGCTGGGCTTCCAGCCGGCAAGGCTATCGTTTGGGCGGTCTGCAAAGTCAGCATCAAC
ATGGATCCTCGCAGCAGCCGGACTCTGGGCACTGGTGAGCTCAGTCGGTCGTCTGCGGACCACGACACCGACAGAGTTTG
GCTGGACCGACATTCAGCCGAGTCGCGACCTGATGTGGCACGCCTGCTATGGCGGCGAGTTTGAGTGCGCGCGCCTGGAC
CTGCCGATGGACTGGGTCGAGCCGTCAGACAGACAGCGGGTGTATCTGGCCGTGATCCGGCTACCGGCAAAGACACGGCA
AGACTATCGCGGGCCAGTTTTTGTCAACCCAGGGGTGTGTACGGCTTACGGACTCACTACGATTCGTGACTGACTCAATG
TAGGGACCTGGCGGTTCTGGAGTCGACTTCCTGGTCGATCACGGTAAAGAGATGCAGACTATTGTTGGCGACAACCAGGT
AAGTCTTATGTGATCACCGCACCCCATCTTATCTCTGACAGCCGAAGGACATGATCAGCTTCGATCCTCGTGGAGGTGAG
TACCAACATATCATAGCCAATAGCTGTTGGACCGTCTGCTGATTCTGGCTCTCAGTGTATGCCTCAGTCCCACGTGTCGA
CTGCTGGGGTTCCTCGCACACACGCCACGACTGGGAGCGGACGTCGATCGATGTGCTGGATGCGCATCCGGGCCTCGTGT
ACGAGTCGTATGCGGCAGCGGATGCCTTCTCGCGCCAGTGCGAAGCCCACATGAACGCGACCGCACCGGGGCTGCTGGAG
CACATCAGCACGGCGTCACACGCGCGCGATATGCTGGCGATTGCCGAGGCGGCCGGCCAGACGAAGCTGCGATACTGGGG
CATCAGCTACGGAACTATCCTCGGTGGCACCTTTGCGGCCATGTTTCCCGACCGAGTCGAGCGTCTCGTCAGCGACGGCA
ACGTCGACTATGCCAGCTGGTATCGGCTCGACCAGCGCAACTTTTTCGAGGACACCGACTCCATCATGGAGGCCTTCTTC
CACTTCTGCCACAAGGCCGGGCCCGATCGCTGCGCCTTTGCTCTTCCGGCCTCGTCAGATTCGTCGCCAGCTGCCATCCG
GGACCGTTTTTTCACCCTGTTGGCCCAGCTCAAGATGAAGCCGGTCCTGATCCCGGCCCACGCCTTTGACACTGCCCGTC
AGCTGCCGATTTTGCCCGAGCTCGTGACTTACGCCAAGCTGCAGGTGCTCGTACGCACCGTGCTCTACAAGCCGTTTTAT
GACTTTCCCGCGCTGGCCAAAGCCATGACCGCACTTGAACAGGGCGATGGCCGGCCGTTTTACGCCATGGCCGGCGACGA
CGATCTGCTGCAGCCCAAGATCTGCTCGCCCAACGCCGACGACACCGAGCCTGGCGGCCTCGAGGACGCTGACAGAAACT
GGGGCGACGTCTTTTCGGCCATCACGTGTGCCGACGGCGACGACGTGGCCGACACGCCCGACTCGTTTGCTGACTACGCC
GCCGAACTGCAAAACATCAGCCGCTATGCCGGCACCGCCTACTCGCACTTTCGCCGTGGCTGTATCGGCCGCCAGATTCG
CCCGCACTATCGCTATGCAGCGCCATGGCCCGGCTCTCTGCCCAATACGAGCTTCCCCATCCTCTTCATCGGAAACACCG
GCGACAATGTCACGCCGCTGAGCAGCGCCTACCGCAACTCTGCCGTCTTTCCCGGCTCTGTCGTGCTCGTGCAAAAGTCG
TGGGGCCACGCCAGCATGGCTGCTCCGTCCACTTGTACCGCCCAGACCGTCCGGGCCTACTTCCAGGACGGCCAGCTACC
GCCAGCCGACACGTACTGCGAGCAGGACTTTGAGCTGTTTGCCGACTCGGAGACCGTCAAGGATGCCATGGGAAGTGCCA
ACGACATTTCTCGAGCCATTCGCAAGCTCACCAGCGAGGTGTCGTTGGGCCGCATAGGGAAGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62