GenePrediction:GLEAN_195 Details

Name: GLEAN_195
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:157129..157622 (+ strand)
Length: 494
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:157129..157363 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_167:157414..157622 (+ strand)
Length: 209
>GLEAN_195 class=GenePrediction position=GCSC_167:157129..157622 (+ strand)
ATGTCGTTTCTCACCGGTGTCTCTGCCCGCCGGCTGACAGTGGCTCTGCCCCGCAGCAATGCTACGTCCTTTACTACAAC
ACCAATCGCGTGCGCCATTTCGCTGCAGCACCAGCGGAGCACCTTCTCGACGACGCCTTTGCGTGCCAAGACGGCCACCG
AGACAGCCAAGGACACACTCAAAACAATTGACCGGACCGTGTCTGACAAGCTGGTGGACGGCATTGATGCAGGATGTAAG
CTCGGTCTCCTTTCCGCACTTGATATTCTTTACTGACAATAGCAGCCAACGTTGCAGGAAAGATACGTGATGCCGCGGAG
AGCATCCAGAGCCAGGCTTCCAGCAAGACCTCGGAGCTTAAGGGCGCGGCATCCGAGATGCAGGGCAAGGCCTCCGGCAA
GGCTGCGCAAATCAAGGGCGAGGCCAAAGGAAAGGCAAATGAGATGGCGGCGGACGCCAAGGGAAAGGCAGACGAGGTCA
AAAAGAGTATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62