GenePrediction:GLEAN_1964 Details

Name: GLEAN_1964
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2253426..2253995 (+ strand)
Length: 570
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2253426..2253483 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_144:2253548..2253864 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_144:2253933..2253995 (+ strand)
Length: 63
>GLEAN_1964 class=GenePrediction position=GCSC_144:2253426..2253995 (+ strand)
ATGGGCCGTCTTATTAAGAACCACTGGGCACGGCTCATCGTCATGAGTGCAGCGGCCTGTACGTTCCTCCCAACATGTTA
TTTCGACTTGCATATTACCTCTTCGTACTGACTCCGTCTTAGACCAGATTGCTGCCGCAATTGAGTGCTTCTTCTGGCCA
AAGATCCTCTGGGACTTTCTCACCAGAGCACTTGACCCGGCCATCAAGCCCTTTCCCACTCTGCAGATAATAAACGTGCT
CATGGGCTTAGCCGTATTAGCTTGGGAGTGGCCGCTGGGCGCCATAGCTGGTAGCGTCATGCACCGCAGCATCGATTTGC
GTCTGGCCTTGCTCCCATTGACAGCCCTTCTTGCTGTGCTGTTGTACCAGGGCACAAATGCGGCTCTATACTACCTCATC
GGCATGGGAGTATACTTCTGGGCCTTCAGCGAAGGAGAGGTAAGCAACAACAGCCCTAGTGGTCTAGCAGTTACAAACGG
CAAGTTCAAAGCTGACTTCTAATGCAGATGATCTGTGCCAAACCCTGGACATTGCCACAGCGGGGGACCTCTGGTGCGAG
CCGTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62