GenePrediction:GLEAN_1965 Details

Name: GLEAN_1965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2261883..2262935 (+ strand)
Length: 1053
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2261883..2261957 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_144:2262107..2262199 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_144:2262295..2262311 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_144:2262385..2262449 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_144:2262540..2262745 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_144:2262804..2262935 (+ strand)
Length: 132
>GLEAN_1965 class=GenePrediction position=GCSC_144:2261883..2262935 (+ strand)
ATGGCTGAAGCTGCGCAAGGGAGCAATGTGCCCACCTTCAAGTTGGTGCTGGTCGGCGATGGCGGTACTGGCAAGGTATG
AAACACATGTCTGATGCGGTTGATATCATCATAGCAATTAGGCCACATGGCTTTCAACATCTCGATCCATGCTGGGATAA
CTTTCTGCTGTGATGAATCTGGTCGACATGCGCTAACAAAGCCTGTTTTGCTACGTCAACATAGACCACTTTCGTCAAGC
GTCATTTGACTGGTGAATTTGAGAAGAAGTACATGGCCACTCTTGGTGTCGAGGTCCACCCTCTGGCCTTTACCACAGTA
AGCCAGATGCTCACTTTCGCTGATGAAACATAAAGCCAGCAGCGCATTGTTTCGAGATGAGTAATACATGCTAACAATGC
TCTGCAATCAAGAACTTCGGCAACATCCAGTTTGATGTTTGGGACACGGCTGGCCAGGAGAAGTTCGGCGGTCTCCGCGA
TGGCTACTACATCAACGGGCAGTGCGGCATCGATCATGTTTGACGTGACGTCCCGTATCACGTACAAGAACGTGCCCAAC
TGGCACCGTATGTCACACTTTCATTGCTACACCTTACCGTGCGATTTACTATACCTCATTTCTTGCTTGTTTGCTTACAT
TCCTGTTACTTTTCTAGGTGACCTCGTCCGCGTTTGCGAAAACATTCCGATTGTTCTTTGCGGCAACAAGGTCGATGTCA
AGGAGCGCAAGGTCAAGGCCAAGACCATCACATTCCACCGCAAGAAGAACCTGCAATACTACGATATATCGGCCAAGTCC
AACTACAAATTTGAGAAGCCGTTCCTGTGGCTGGCCCGCAAGCTCGTCGGCAACCCATCTCTGGTATGTTTTGATCTAGC
CTGGTTATTTTCCAGATGCGTAGATAAGCTGACAAAAAAAGGACTTTGTCGCTGCCCCGGCTCTTGCCCCCCCCACAGCC
CAGGTTGACGAGGCGCTACTGGCTCAGTACCACCAGGAGATGGTCGATGCTGCCGGAATGCCGCTGCCGGAGGAGGACGA
TGATGATTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62