GenePrediction:GLEAN_1966 Details

Name: GLEAN_1966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2265730..2268321 (+ strand)
Length: 2592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2265730..2265792 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_144:2266395..2266508 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_144:2266573..2268321 (+ strand)
Length: 1749
>GLEAN_1966 class=GenePrediction position=GCSC_144:2265730..2268321 (+ strand)
ATGCACCGGAAATGGAGCGCTAGCGATGCGGCGCTACACTGCACCGCTACAACACGCTTCGCGGTCTCGTGTCTCTTGTA
TATTGTATACGCCGTAAATGTACTGTATTTTGTGGGCTTCTTATAATTCTCGTGTCTTGTCTGGGACTTGTCTTCTTTGC
TCCTTCTTTCCCGTCCTCTCCTCCCCTCCGTCTCTCCGCCGCTCAATGCTTCCGTTCACGAGCCACACGCGCTGAAGCTG
CCGTTCATTTTGCTTTGCTTTACCTTTCCTTCGGCTTCCTTCTTTTGCCGGGCCTCCCCCCCCCCTCACCCCCGTTTCTT
CTTTTGCCCCGGAACCCGCGTCACCCGGATCCTCTTCGCCTTCTGTGGCGCTGGGCCTGCCACAGCAGCCACGAGTTATC
GCCACTGTCTCCAGCGACCCATTGATCTCGTCTCCAAACAGCGGCCACAGCAGCAGCAGCAGCAGTGGCGGCAGCAACGA
CAGCGGCATCAGTGGGCTGACAGACGATGCTACTGCTCCTTCCTCGGACGCGGCCGACGACAGCCTTTTGCGGCATCCGA
AGGGAAAGCGGAAGAGAACTGCGTAAGTCTTCGACACGTCGACCCCTAAGCCGCGTGTTCTTGGGGGTAAACAATGCTAA
TTACCGCGACTTTGGCGCGTTGTAGGGCCAAGGACAAAAGCCATTCTCGAAGGTGCCTACCTTGCCAATCCCCAAGCCAG
ATAAGACGGCCCGTCTTGACATTGTCAGCCAAGTTTCTCTCAACGAGAAGGAGGTTCAGGTATGTCGCCAGGCGCAAAGT
CTGCCAAGGCGGCTGCTGTGCTCTTGCTGACTTGGGCTTGCAGATATGGTTCCAAAATCGCAGACAAAACGATCGCCGGA
AATCACGCCCCCTCTTTCCCCAGGAGATAGCCGTCTTGCGCCTAGGTGGCTTGCATGCCTTCTCGTCTGACTCCCCGCCA
TCGCTTATTCGCAGCTCCATATCCTACCCTAATGGTGCTCTCTCCTCATCCCCACCACACCTAGCTCGCAATGAACCCTC
GACGACGCCGCTTTCCTCTCCTGAACTTGGACCGTGGGAACCAGAGGCACTGGCCCGGAAGCAGGCCGAAGAGCAGCAGC
TACTGCAACGACAGGAACGCGATCATCCGTTCCAGAGCGCAAGAAACGGTGCACAGACGCCGTCTCTGTCGTTTTCAAGC
TCCACAAGCTCAGTCGGATATCTGGCCAACCGTTGGAACGCACACAGTTCGTTCTCTACCCCGTCTTCTACCTTCCATGT
CAACGGCTTCGGCAGTATCGGCCGTGACGGCTGCCAAGACGATTTGGTCAAGACGGATCCCTTTGCACCTCTGTCATCCG
CACCTGCTGTGCTCCCACCGCCGCACCAACAGCATCAGCTGCGACGACCATCCCAACGACCGTTCCGTATCTCTCTCTCC
CTTGACGGCAAGGCCGAAGTGATTGCGGGCCTGTCTCCCTCGCCACCGCGGCGACTACCGCCACCTCAGCTCACCGCTGC
AATTCCTTTTGGTAGAAGGAGTGGCAGCAGGAGCAGCACTGGCAGTGACGGCCATCTACCGTCTCTTCCAGCCATTCAGC
GAGCCGGGCTCAGCCGAAGCCAATCCGCTATCAGTCTGGGCAGCGGTCTCACTCTGCCTCCCATCTCCAGCCTGACCGGC
TCGCTAGAGAGCGGCTCTATCCCTGCACCACCCTCGCAACCAGTGCACCCGCCTAGACTGATGCGCGGTCGTTCACGCGA
TGTGCACGCGTGGGTCTCGGTTTGCAATGCTGAGATCCGTATCGACGACGAGCTGAGTGCCCAGGCACAGCATGAGATCA
GTGGTTCGGCTATCGCTGCCATAAGCCTGCTGCGTTCGACGTCTGCGAACGCTGGTGCGGCTTCGGTCTCATCCTCGGTG
CTCCAGCCCAACTCCAGTAAGCGAAACACGACTGGACGGCCGACAGCGCCGAGACTCGGTGGCAAGCGTCCCAAACTGGT
CCGATCATCCAGCAGTGTTGCCCGCTTGCAGAGCGTTCCGCCGTCGCATGGTGCGAAAGTGGGCGAGGAAAACGACGAGG
TTTGGGTCGACGACGAGAAGAAGAAGAAGCTGAAGCTGTCCACACTGCTTTCCGGAAACGATTCTGACAAGGAAAACTGG
AGTCCGGATGAAGATGGACGTCCTGTGTCGGTGCACTCGCAGCGGCCTAGTGGCACAGGCAACAGCGGGAGACGGCCTCT
TCCATCGGCGCGGACGGCACAGCAACAGCGAGCTATCGCTGGTCGTGTGCTAAATTACTGCAACATCAACAAAAACAGAG
ACTTTCGGAACAGCTCGAACTTGCTCGCCAAGCGCCAAAATGGTGGCAAGTCCGGTAGCGGGCTATCCGGTGGGCTAGAC
ATCTTTGAGGATTCGTCTTCTGAAGGTGGTGATGCCCCAACAAAACGGGCGCCCTTGTCGCGGGCAGCCACCATCCCGGG
TACAGACGACGTGGAGAAATTCATGCGCAGTGGTGAGGCCAGCCCAAGCAAGAAGGGTGACCTGGACTGTGTTGCTGGCC
TGCTGTCGCTGTCCCAAGGCATCTGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62