GenePrediction:GLEAN_1970 Details

Name: GLEAN_1970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2292364..2294372 (+ strand)
Length: 2009
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2292364..2292412 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_144:2292551..2292625 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_144:2292688..2292904 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_144:2292973..2293248 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_144:2293345..2293594 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_144:2293660..2293875 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_144:2293945..2293973 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_144:2294036..2294372 (+ strand)
Length: 337
>GLEAN_1970 class=GenePrediction position=GCSC_144:2292364..2294372 (+ strand)
ATGTTGAACATAGTGGGCGGCACGCGGCGCCGTGCAGCTTCCAGTGCCAGTACGCCATCCTGACCCCTATTCGATAAAGT
CCCTGCTGGCCAGTGCTCGTATCGCTGTGGGAGAGCACGCCTCGCCTGCTTTCGCCCCTGAAGGAGGTCACATCGCAGAC
GTACACTGACTAGAATTTATTCAACAGGTGCCCATCCGGTCCAGTCCAGCGAAGAGGCCCAGGAGGATGACACGCTTATC
GTGGAGCCCGAGCAGGGAAACGGTACGAGCCGAGGATGTAGTGCTCTTCCATGTTTTAACCGCCCACTGACGCTCGTGCC
CCAGTTCTGATGCATATCATCTCTCAGCTACGGCCCGGCGCTGATCTCAGCAGGGTTGTTCTCCCGACCTTTATCCTGGA
GCCGCGCAGCATGCTAGAGAGAATTACGAACTTTATGTGCCATCCCGAAATGCTCCTCCCCATATCCGCCATTGAGGACC
CTGTTGAGCGATTCGTGTCCGTTGTCAAGTTCTACCTGAGCGGTTGGCACATTCGGCCTCCGTGGGTCCTCCCCTGTCTC
CTGTTGCCACATTATGTCTATACACCGGAACTGACCGTACGTCTGTCAGGGGCGTGAAAAAGCCTCTCAATCCCATCCTC
GGCGAGGTCTTCACGTGCTACTGGACCTTTCCGGACAACACTCAGGGCTATTACGTCTCCGAGCAAACATCGCACCATCC
GCCCAAGTCCAGCTATTTCTACATGGCCCCCGAGCATCATATTCGTGTCGATGGCACGCTTAAGCCGCGGAGTCGTTTCT
TGGGCAACTCCGCCGCCAGCATCATGGAAGGGACAGCTGTCCTGAGCCTGCTAAACCGAAAAAAGAACGGCAAACCGGAA
CGATAGTACGCTTTTCTGAGTCCCATTTGGCCACAATGCCAGGCCGGGTCAGACAAAAAATATTTGCCGTCTGGCTGACA
ATTTTTACTCCTCTCGTCTAGTATCCTCACCCAGCCAAACATGTACGCACGAGGTATCCTGTTTGGCAAAATGAAATACG
AGCTGGGGGACCACAGCTTCGTGCGCTGCCCTGATCTCGGTCTCGTTGCAGATATCGAGTTCAAGACCAAGGGTTGGGTG
AGCGGCACGTACAACGCCATTGGCGGTACTGTTCGAAACGAGAAGACTGGAGAGGTCCTGCGCGAACTGTCCGGCCTGTG
GAGTGGGGAAATGGCCATCAAGAACTTGCAGGTAGGCAAGAGAAGCGAGATCGTGTATGGGGGATGTCTTGATTACTAAT
ACGACTCATTCTTCAGACGGGAAGAAAGGAGAAATTCTTCAATGCCCAGAAAGCGAAGCCAACTTCGCCATCGGTACGGC
CAATCACTGAGCAGGGTGATCGAGAATCGCAACGGCTTTGGCAGCAAACGGCCCAAGCCGTGATGAACCGGAACCACGAG
CTAGCCACGGTTGAAAAAACCAAGGTCGAAGACATGCAGCGCGAGGAGGCCGCTACACGGTCGCAAGAGGGCGTCGAGTG
AAAGCCGCGCCTATTTCGACGCCCCATGGCCGGCCCCGGTGGCCTCTAAAATTGCCAACAGGACTTGGGATGGATTGTTA
AAGGCCAGATGTGTGTATCTGCCAGTCGGGGGCTTCCTCTTATCGCCGTTCATCCAATGACACCCCGCTTAGTGATGGCA
AAACGGCCGACGAACAAACGGCTCAGATTCTCGCCATTTACCCCATCCTGCCAGGCCAGAAGACAAAGCGAGGTAGCGTA
CAGGCGATCCCGCCTCGGACGCTAGATACTGCACCCAGTGGCGCCGCACATGCGCCTGTTGAGGGCAGCCTGATCGATGT
CGGCTCGAGCGACAACACGCCTGCGGCAAACGAGAAAAGTGATAATAGTGCTGAGAATGCGCTGGAGGCTACAGGCCAAC
AACCAGCCCCATTGGGCGCCTTACTCGACTTTCAGCAAGACTTGGGCAAAGATTTACCAGATGCTCATCCGTCCGACGCA
AGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62