GenePrediction:GLEAN_1971 Details

Name: GLEAN_1971
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2295538..2300266 (+ strand)
Length: 4729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2295538..2296260 (+ strand)
Length: 723
Type: CDS
Source: GLEAN
Position: GCSC_144:2296312..2296583 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_144:2296655..2298375 (+ strand)
Length: 1721
Type: CDS
Source: GLEAN
Position: GCSC_144:2298501..2299354 (+ strand)
Length: 854
Type: CDS
Source: GLEAN
Position: GCSC_144:2299505..2300266 (+ strand)
Length: 762
>GLEAN_1971 class=GenePrediction position=GCSC_144:2295538..2300266 (+ strand)
ATGGCAAGGTCGGCAGTATCGCAGGAGAGCCTGCGTTTGGCAGATTCCTCTCGGTCATCTGAGGAGGCAGGCCCTGAAGA
GTTTATGGCCATTCGAACAAACGGCCCCGAAGCATCTGATGCGGGAACGTATCGCCCCCAGCGACGGGATTCGACGGCCA
TGATAGAAGAGAGTGATGTGCAGGAGCTGCGGATGCTTGCCACGGCCATATCGCAAAGACGTCGCCAGAGCCACGCCACC
GGCTCCGAGGCTGGCAACGAGGACTTTGATGCTGCCGATTCTGCCATGGATCCCTCTAGCAAGTCATTCGATCTCGGGGT
TTTCCTGCGTCGCATCATCAAAGATTTTCGCAAGGAAGGTTTCAAAGAGCGGCGTCTGGGGATTTCCTACAAAGACCTTA
CCGTGTCCGGCACGGGAGAGGCCTTGCAACTGCAGAGCACGGTGGGAACCGTTCTCCAAATGCCATTAAGGCTTGGCGAG
TCCTTCAGTTTCGGCAAGAAGAGTCACAAGACCATTCTCCACAACTTTGACGGTCATGTCGAGAGCGGCGAGCTGTTGAT
TGTGCTCGGACGACCAGGATCGGGGTGTAGCACCCTGCTCAAAACCATCACCGGACAATTGCATGGGCTGAAAATCGGCG
AGCAGTCGACAATTGATTACAACGGCATCCCCATGAAACACATGATCAAGGTATTCAAAGGAGAAGTATTAAAGAACCAA
GAGGTACGTTCCTTCCCATTCTGTCACTTTTGGATCAAACTAACCTCTTCTTAGGTCGACAAGCATTTCCCCCACCTCAC
CGTCGGTCAAACGCTGGAATTTGCAGCTGCAACACGTACGCCATCGAAGCGAATCCATGCCATAACGCGCGAAGAGCACA
TCAAGCATGCCGCCAGGATCGTCATGGCCATCTGTGGCTTGAGCCATACGTACAACACCAAAGTGGGCAATGACTTCATC
CGGGGTGTCTCTGGTGGTGAGAGAAAGCGTGTGAGCATTGCCGAAATGATGCTGGCAGGATCGCCCATTGCGGCTTGGGA
TAACAGGTGAGTAGTCGTACTGCCGTCGCCAAGTTGGACACTTTGATCTGACCGCTTACTTATTTCTTCCTTTACAGCAC
CCGCGGCCTAGATTCCGCCACTGCGCTGAAGTTTGTCCAGTCTTTGCGGCTGGCTGCCGATTTCACCCACAGTGTTCATT
GCGTCGCTATTTACCAGGCCAGCCAGGCCATCTATGACCTCTTTGACAAAGCTGTCGTGCTTTATGAAGGCCGCCAGATC
TACTTTGGTCCAGCACCCGCTGCCAAGGCCTACTTTGAAACCATGGGATGGTTTTGCCCTCAGCGGCAGACCACGGGTGA
TTTTCTTACATCTGTCACCAACCCGCAGGAAAGGGTCGCGCGTGAGGGGATGGAAAACAAGGTTCCACGGACACCAGAGG
AATTCGAAGCATACTGGTACCAGTCGCCCGACTGCAAGGCTCTTCGAAATGCCATGGAGAAGCACGAGGCCATACATCCC
ATCGATCCTCACGGCCAGACGGCCGTAAATATGCGCGAAAACAAGCAGCAACGCCAGGCAAAGCACGTGCGGCCAAAATC
GCCATATATCATCAGTGTAGCCATGCAGGTGCGCCTCACCACCAAGCGGGCATACCAACGCATCCTAAACGACATTTCGG
CTACTGCGACACAAGCTGTGATGCAGGTCGTTTTGGCGCTCATCATCGGCTCCGTCTTCTACGGCACTCCCAACGCGACA
GCCGGCTTTTACGCCAAAGGCTCCGTGATCTTCCAGGCCATTCTTATGAACGCCTTGACGGCAATCTCCGAAATTAACAA
ACTGTATGCACAACGTCCCATCGTCGAGAAACATGCCGCCTACGCCTTTTATCATCCCTATACAGAAGCGCTGGCTGGAA
TCATGACTGATATCCCCATCAAGTTTATCACGGGAACCATTTTCAACCTCATCGTCTACTTTATGTCGGGGCTTCGACGC
GAACCGGCTCAGTTCTTCTTGTTTTTCCTCATTACGTATACCACAACGTTTGTCATGAGTGCCATCTTCCGTACCCTGGC
TGCCATCACAAAAACCGTGTCTCAGGCGATGATGTTGGCCGGTGTTATGGTTCTGGCTCTTGTCATCTATACTGGATTCG
TGGTTACTGTGCCCAAGATGCATCCGTGGTTTAGCTGGATCAGATGGATCAATCCTGTCTACTACGCTTTCGAAGTCCTC
ATTGCGAATGAGTTTCATGGCCGTTCGTTCACCTGCTCGAGTATTATCCCCGCCTACACACCCTTGGTAGGCGATTCTTG
GATATGCTCGGTTGCCAGCTCGGTTGCTGGACAGCATACAGTTAGCGGAGATGCCTTTATCGGTGTTCACTACAAGTACT
ACTACGCGCACGCCTGGAGAAATTTCGGTATTCTACTCGCGTTTCTGTTCGCCTTCATGTTTGTTTACTTCGTCTCGACC
GAACTAAACTCGCAGACCACCAGCGCAGCCGAAGTCCTGGTTTTCCAACGCGGCCATGTTCCTGCATATCTCCTAAACGG
GGGCAACAAAGGTGCAATTACAGAAGACATGACGAAGGCCTCGCCGCAACAAGACGGAAACGAAAAGACCGATGCTATCG
AGCCACAAACCGATGTGTTTACCTGGCGCGATGTAGTCTATGATGTTACAATCAAAGGACAGGATCGTCGGTTGCTTAAT
CATGTCTCTGGCTGGGTAAAGCCTGGAACTTTGACGGCACTAATGGGAGTCAGCGGTGCTGGCAAGACAACACTACTCGA
TGCCTTAGCCCAAAGGACCACGATGGGTGTTATTACGGGTGATATGTTTGTCAACGGAAAGCATATTGATGCTAGCTTCC
AAAGGAATACCGGTTACGTTCAGCAACAAGGCAAGCTTTTTTCCAACCCTTTTATATAGCATAACAGTCGCTAACAAACG
CAGATTTGCATCTATCGACAGCAACGGTTCGCGAAAGTCTCCGTTTCAGTGCTATGCTTCGTCAGCCTCAAAGCGTCAGC
AAAGAAGAGAAGTTCACCTTTGTTGAGGAAGTGATCGACATGCTGGACATGCGGGACTTCGCAAATGCCGTCGTCGGCGT
TCCTGGCCAAGGGCTCAATGTGGAACAACGCAAGCTACTTACTATTGGTGTCGAATTGGCCGCCAAACCAAAACTGCTAC
TCTTCCTCGATGAGCCTACCAGCGGTCTCGATTCCCAGAGTTCATGGGCTATCTGTGCCTTCCTCCGAAAGCTAGCTGAC
CACGGCCAGGCTGTGCTCTGTACCATACACCAGCCCAGTGCAGTTCTGTTCCAGCAGTTCGACCGGCTACTGTTCCTCGC
TGCCGGAGGCAAGACCGTCTACTTCGGCGACATTGGGGAGAACTCGCGGACGTTGCTCGAATACTTTGAAACCCACGGCG
CTGAAAAGTGCGGCGACGAGGAAAATCCAGCCGAGTACATGCTCAACATTGTCAACCGCGGCAGCAATTCACAGGGTGAG
GATTGGCACGACGTCTGGAACAACAGCCGGGAACGCCAGGACGTAATGGCCGAAATCAATCGCATTCATGTGGATCGCGC
TGCGCAGCCGCTTGCCACTCACGAGGATCCGCACTCTCGCGATGAATTTGCCATGCCGTTTGGCGCCCAACTAGCAAGGG
TTGCAACGCGCGTGTGCCAGCAATACTGGCGCAGCCCAACCTATGTTTTCTCAAAGTTCATCCTTGGCACTGTGGCTGGC
CTGTTCATTGGCTTCTCGTTTTTCGGAGCCGACGGTACGCTGGCGGGCATGCAAAATGTCATCTTTTGCCGTTGTTCATG
GTGATCACAATATTTTCTACCCTGGTCCAGCAAGTAAGTCATGCCGCCACACCTCTGTCAAACTCGCACATACCGCCAGT
ACGTCTTGCTAATTTTTCGTCAGATCCAACCACATTTCATTACCCAGCGTGACCTGTATGAAGTGCGAGAGCGTCCCAGC
AAGGCCTATTCCTGGAAGGCTTTCATGATCGCCAACGTTATCGTCGAAATACCATATCAGATCTTAACTGGAATTCTTAT
TTATGCCAGCTTCTATTACGCAGTCATTGGCATCCAGTCGTCTGCCCGCCAGGGTCTCATCCTTCTTTTCTGCATTCAGT
TCATGCTTTATGCTAGTTCCTTCGCCCAGATGACTATCGCTTCCATGCCCGTTGCCGAAACTGCAGCCAGTATTGTCACT
CTCCTGCTCTTGTTCAGCCTTACCTTCTGTGGTGTCCTCCAGACACCCTCGGCTCTTCCGGGATTCTGGATTTTCATGCA
CCGTGTCAGCCCATTCACTTATTGGGTCGCGGGCATTGTTTCTACGCAACTCCATGGCCGCGCTGTGGATTGCTCCAAAT
CTGAGACGAGCATTTTCAGTCCGCCCGCAGGAATGACATGTGGTGAATATATGGCGCCATACCTGACCCAAGCTCCTGGG
AATCTGCAGAACCCAAACGACACCGAGAATTGCAGATACTGTTCGCTGAAGGTGGCAGTCCAGTATCTCGCTCAAAGCAG
CATCTTCTATTCTCAGCGCTGGAGAAATTTCGGGATCATGTGGGCGTATATCGCTTTCAACATCTTTATTGCTGTAATCT
CGTATTGGGCTTTCCGGGTGAAGAAATGGAATCGGGGGGGTAAGAGCGCGAAGAAGACTTCGGAAAAAAACAAGACGGAG
AAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62