GenePrediction:GLEAN_1972 Details

Name: GLEAN_1972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2305170..2309777 (+ strand)
Length: 4608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2305170..2305367 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_144:2305432..2308350 (+ strand)
Length: 2919
Type: CDS
Source: GLEAN
Position: GCSC_144:2308419..2309777 (+ strand)
Length: 1359
>GLEAN_1972 class=GenePrediction position=GCSC_144:2305170..2309777 (+ strand)
ATGGCGGCGACTACCGAGAAGGCGGCGGGCGAGCTGAAGCAGCAGGGCGCCATCGAGGCTGCCCAGAGGTCTAACGGCAC
CGTCACCTCTACACAAGCGCAGGCCAAGATCGTGCAGGAGAGCAATAGGGCTGGTGTCATGGCTTTCAACTTCGACCCTG
ATGCCAGCCCCGAAGCAAAGAGGGCACAGGTGCGGGCGGTATGTGTCCATATCCCTGTTTTCTTTCCCCCTTTCCCCTGA
TGCCTTGCTAACTTTCGTCTAGGCTGTTCCCGAGGGCTTTCACAACCCTAAGCACATAAAAGGGCTTGCAGTAGCCACTG
ACATCGACGACGGCACTGCACCCGCCTACGACCTCCCTACCCCGAGCAAAGCTGGCGCCATCGACGTGTCGGCAGAAACG
TCCGGACTGGGAGATGGCGAGAATGGCGTCGAGATGGGCCCTGACACGACTGGCTGGGCCCCTCGCTTCGGTTGGCCTTA
CGAGTCTATTGCCGATTCCCCCTCTATGTTGGAGCACTCCACCTGGCTCGAGGGCCAGATACCCGACAAGTTTTTTGGGG
ACTGGTATTACAACGCGGGCGTAATTGTCTTTGCCTGCTTGAGCTCCTGGTTTGTTGCCGTACTTGGCGGCGGCTTGGGC
TGGGTCCTCATTATCATGGCCGGCTGCTCTACGTACTACCGCACCTCTGTACGCCGCGTTCGCCGCAACTTCCGCGATGA
CCTCAATCGCGAACTGTCGCTCAAGCGCCTCGAGACCGATACGGAATCTCTCGAGTGGATCAACTCGTTTCTCCTCAAGT
TCTGGCCCATCTACCAGCCCGTTCTGGCACAGACGATCATCAACTCCGTCGACCAGGTTCTCAGCGGTGCCACTCCTTCC
TTCCTGGACAGCCTGAAGCTCAGCTCTTTCACTCTGGGCTCGAAGCCACCCCGCATGGAACACGTAAAGACATACCCCAA
GGTGGAGGATGATATTGTTGTCATGGATTGGAAATTCAGCTTCACCCCCAACGACACTGCCGACATGACTGCCCGCCAAA
TCCAGAACAAGATCAACCCAAAGGTTGTGCTTGAAATCCGTATCGGCAAGGCCATGATCAGCAAGGGCATGGATGTTATT
GTTGAAGACTTTGCCTTTTCTGGCATCATGCGCCTCAAGATCAAGCTACAGATTGCCTTCCCTCACATCGAGAAGGTGGA
GATGTGCTTTTTGGAAAAGCCCTCGATTGACTACGTCTGCAAGCCTCTCGGCGGTGAGACGTTCGGCATCGACATTAATT
TCGTTCCAGGCCTGGAAAGCTTCATCCTCGAGCAGATTCACGGCAACCTAGCTCCTATGATGTATGCGCCCAATGTCTTC
CCCATTGAGGTGGCTAAGATGCTGTCTGGCTCGCCCGTCGACCAGGCCATCGGAGTCTTGGCCATCACGATCCACGGTGC
TCAGGGCTTGAAGAACACGGACAGCTTTGCAGGCAATGTCGACCCGTACGCTGTTATCACCTTGAACAGGCGGCAACCTC
TTGCACAGACCAAGACTATTAGGGATACGAACTCGCCGCGCTGGAACGAGACACACTACATTATCATTACGTCTTTCAAC
GATTCTCTCGACATAATTGTGTATGATTTCAACGACTTCCGTAAGGACAAGGAATTGGGCGTGGCTTCTTTCTCTCTGGA
GGATGTGGAAGAGATCAACGAATTTGAGAATGAATCCCTGGAGATCATCGCTGGTGGCAAAGCTCGGGGCAACCTCAGCT
GTGATGTTCGATTTTTCCCCGTCCTAGAGGCTGAGAAGGGTCCGGACGGGAAGGTCGAGCCCCTCCCGCCATCGAACACC
GGTATTTTGCGCTTCACCGTTGAACAGGCCAAGGATCTAGATGGAACAAAGAGTTTGGTTGGCCAGCTCAACCCGTATGC
CAGCCTGCTGCTGAATGGCAAGGAAATTCACACTACGAAAAAGCTCAAGCGCACCAACAACCCGATCTGGGACAACGGCT
CCAAGGAGATTCTCATCACCGATCGCAAGGCGGCCAAAATGGGTGTTGTTATCAAGGACGAGCGAGACCTTGCAGGCGAC
CAGATTATGGGTACCTACCAGATCAAGCTAGAGGACATGCTCGAGTTCATGGAAAAGGGCCAGGATTGGTACAGCCTAGC
AGGTGCAAAGAGCGGCCGTGTCAAGATGCAGGCCCAATGGAGGCCAGTCACCATTACCGGAGTGTCCGGTGGAACTGGTG
GCTATCAAATACCCATTGGTGTCATTCGATTGCACTTCATCAAGGGCTCCAGCCTGCGCAACTTTGAGAAGGTGGGCAAA
TCCGATCCCTATGTGCGTGTGCTTCTCTCCGGAATCGAGAAGGCCCGCACGGTCACGTTCAAGAACAACCTCGATCCGGA
GTGGGATGAGGTGCTGTATATCCCTGTTCACAGCACGCGCGAGCGGCTACAACTGGAGGTCATGGATGCTGAGTCCATGG
GCCGCGACCGCAGCCTGGGTCTGGTCGAGGTCGTTGCCGGAGACTATATCTCGGAGGAAGAGGATGGTTCTTATGCCGTC
AACGACACCAAGATGCAGCGTGACGACGGACTTCGGATGCACGGCAAGGGCATGCCGAAGGGCATACTCTCCTACACGGT
CTCCTTTTTCCCCTGTCTGAACGTTGCTGATCCTGAAGATGAGGAAGAGGAGAAGGAAGCTGGCGCACCCAAGGATGCCG
CTGAAGGTGATGCATCCGCAACTGCTCCGGCGGCTGAGGCGGCGGACGAAAAAGCTGCTGACGCTTCTGTGGTACCGGCG
AACGGTGCGGCATCTGAGGAGGCCGTTGCGAAGGTGTCTGCCGAATCTAAGGGTCTGCCGAAGATCCGGCTGACGCCCGA
GGAGCTTCTCAAATATGAGTCTGGTCTCGTGATCTTCAAGCTCATGGAAGCCGAGCTGCCCAAAAGCGACACACAAATTG
AGATATTCGTCGACGACATGGCCTTCCCGTCTTACATTTCGTCAAAGGCGGCGTCCCGGACTTTCACATTTGACGAGATG
GGCGACTGTTTTATTCGGGAGCTTGATTTCTCGCGTCTCACGCTCAAGGTGCATGAGCGCGGAGACAAGAAGGATGATGA
TAAGGACCGGACGCTGGCTCGCCTGACCGGAAACACGCTGGACACGTTGAAGCAGTGCCTTGTAAGTATATCGCAGAATG
TTTGCTGCCCTTTGTTGCGTGCCGTGCGCGTTGCTGACCGAGTATATAGAACAACCCGACGACTCTCATGATGAAGGGCG
AGGATGGCAAGGTCAGCACCGTCAAGATCAGCCTGAAGTATATTCCTGTGCGGATGCAGCTCGACCCGAGCGAGAGCATT
AACAATATGGGAAATCTGCGGGTGGACATTCTGGACGGCCGTGATCTACCGGCAGCCGACACGAACGGGAAGAGTGACCC
GTACTGCAAGTTCGAGCTGAACGGCCAGGAAGTTTTCAAGAGCAAGGTGCAGAAGAAGACGCTCAACCCTGTGTGGAACG
AGTTCTTCGAGGTGGTGGTGCCGTCGCGGACGGGAGCCAAGTTTGCGGCCAAGGTGTACGACTATGACTTTGCGGACAAG
CCGGACTTTCTTGGTGGCGCGAATATTCGGCTCGACCAGCTTGAGCCGTTCAAAGCACAGGAGCTGACGCTGCCGCTTGA
CGGTAAGTCCGGCTCCATCCGAGTGCGGCTGCTGTTCCGTCCAGACTACATCACGCGTATGAAGCAGGGCACCTCGACAT
TCTCGGGAACGTTTGCGACCCCTGGAAAAATCGTCACGGGCGTTGCGGGCGCGCCCATCAAGGGCGGTGCTGCTGTGGTG
GGTGTCGTCGGCCTTGGTGTCGGCAAGGGCGCGTCGTTCCTCCGCCGTGGATTCAAGGGCAAGAGGGACGATGATGCCAA
TGGCTCGGTGAGCGGCAGCTCGATCGAGCTCTCACGCGGTTCCACGGTCAACGACAGTGGGCCTGCGGTGCCCAGCGTTA
TGGTGCAGCGGGCGACTGGACTGTCGGACGCGGAGCCGTTGGCAGACTCGCCCCCCGGACCTGCAGTCAACAATGTGAGC
GGTGCTCCCCCTCTGGGCGGCCAGTCGCATTCGCGGACGCGAAGCATGGGTGCGTCGTCGGTTCATAGCGTGTTACCCGG
CAGCCCGGGAGCTGGTCAGGCCGTATTTACGATCGTGGCGGCTTCGGAATTCCCGCCATCAACGGACGTGTACGTGGTGC
TCAACCAGCTGGGCTCGCGGTCCAAGGTGGTCGGCAAGACGAAGCACCACAAGGCATCGGGTGGCGCAGTCAAGTTTGAC
GAGACGTTCAAGTTGACATGCACACCGGACACGCAGTTCCAGATCCAGGCGCGCGAGCATCACAGCTTCGGCAGCGACGA
AACGCTGGGTGAGTCGCTGTATGTGGTGGATGAGAGCGGGACGAACAGCGAAAAGGAGATCAGGGTGGGCGACGGTGTGG
TGGTGATCAAGAGCAACTTCACGCCAAACGAGACTTCCCCCAGCGAGAGTCCAAAGTCAACGTTCCGGCGCAGTTTCTTG
AGCAAGCGCGACGCGCGTGCGCCAAGCCGTGATGGCACGCCAACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62