GenePrediction:GLEAN_1973 Details

Name: GLEAN_1973
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2316739..2319352 (+ strand)
Length: 2614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2316739..2316986 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_144:2317445..2317619 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_144:2317712..2317821 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_144:2317884..2317903 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_144:2319270..2319352 (+ strand)
Length: 83
>GLEAN_1973 class=GenePrediction position=GCSC_144:2316739..2319352 (+ strand)
ATGGCCTTTACCTCGTCTGCTTATGATGCTCATGTGGCAGCTCTGGATCATGCCAGCATAACGTCCACCCCTACTACCGC
CAACACTTCCTCTGACAACCACGGTGGCCATGGGGTGACGCCCTCAACGGGGTACTATCACGCACAGAACGCTTTGGCTA
CTGGCCAAGGCCATGCAACCGCACCTAGATTCAGTACTCAGCCGGATCTTACCAGCTCTCAGGGGCCAGTTGGCGTTGCT
GCCGTCTGGTTCGTCTCCGGAGGGATACACGACTTGTGTGGAGGGTGTAGAACCCAGGAATCTAGACTTCAATAAGTGTT
CTGGTGTTTTGCCAGGAGCTGACCACTATCCAACCCACAACGATTGGCAGACAGTTTCCCCGACAAGCCTTCATCGAGGG
GGTTCCCAGGACGTTACAAGTGAAGTTTTGGGAGGTTTTTTCACAACTCCAATGGCCAAGTCAGTACCATTAAGGGCCAG
CCAACAGGTTTGCCCCACCTTAATCGGCAGCAGCGAAGTGACTGTCGAAGCTAGCCATATTTTCAAGGAAAGGCTGACGC
CCGCTTTGCGGGATCGCATGTTTGCTGTCATTCTGCAAACCAACCCGACGGGCTCTTCCGAGACGATGCGAGTAGCCTCT
TTTTTTCCACCTGTGGACGTGCTTGGCAGCCTGATCCACGTATTTCTAGTTTCCCACACCCGCCAGGCGTATCAATGGAT
CGACCTGGGCGCCAACTTCAGGCTTAGCACGCAACATCCCAAAATGGCTACTCAGTGCTGCTGTTGCGGGGGCCGCGTTT
GTGGCCGACAGCAGTGTGCAGCAGTTCCGGCAGGTGTATGAGGAGTCCATTCGAGTGCCTGTGTCTGCTATTTCAGCACA
AGTAAGCCTGAGCTATAATAAAATGGCACGGCAATGCCAACCTTCTGCCTTGCCAGAACGAAGGCGGGCTTTAGAGCTAA
TGGAATGGACTAGAAATCCGTCGACTCCGACGTGGAACTCATGTTGTTGCAGGCCACGGTGCTGTTCCAAGACATTGGCC
TTTGGAGTAGCGAGTATGCGGTGATGGAGATCACACGAGGGTCGTAAGTGGCGCTGGGACCGGATCATGACCGGCCCTGA
TTGATGCTGACTATGTTTTTATCAGACTTGAACATCCCTATCGCTGTAAGACTTGACGACTGAACAACTGGTTGGCTGCC
TGACGCATGAGAAAGGCGTGCTGACACCATGCAACAGGCGATTCGGTCACGAGGCTTATTTCAGCACTCTGTGTATCCTA
TGATTGCAATACACTTCTCGGAGAGTGAAGTTGAGCTGGAGCGGAAGTGGATCCAGTGGGTGGAACAAGAATCGTGGAAG
AGGTGGGCATTATTTTATTCTTCCAATATTCCGTATAGCACAAACTGACGCACAAGTCATCATTAGGCTTGTATTTCATT
GTTACCTTAGAGATGCGCAAGTGTCCATCGCATGGCAAATCCCGCCCCAGATCTCCATTGTCGAGCTGGCTTTGCCGCTT
CCGGAGTCTCGGTCTGTCTGGCAGGCTCGGCATACCCACGAATGGACAAGCAGATATATGGAAGGGACTGCTACCAGACA
TGGAAACTCACGGGGACAGCTTCCAAGCCTGTCTGACCTCTTCCGAGATGTCGGTCTGCTGGCGACTTTTCGGGAAATGC
TGGATGTTCCGTTTGCAACTAGTATCTACCTGCACGGGTTCTGGTCCATAATTTGGCAGCTCCAACAGCTCAACGCGGTT
CGCCAGCCCGGGGGCGGTCTCGGCGATCTAGACAAGACATATGGTGGCATGTACATATTTCCGACACAACCAGAGAATCG
GACAAGTTACCTGCCGCCTTATATGTCGACCTCGTCGCGGGAACCGCTTTGTTGCTCCGGTCGGCCTGGCACTACTGTCA
TCAGTGGTAGCAGCCCTGGATCATTCCCGTCGCTTCTCAAGTCTCGACGGCAAGAGCTGGTCGAGCAGCTGCAGCAACTC
CGGGTGGTATTGCATGGGTGGGACGAGATATGGGCGCAGGAGGAGCTGATGCTGAACCTGCTACAGCTCCACCTGCACAT
ATCGTTGTATGACCTCGAGCTATTTTCTGAGAGAGAGCACAAGGCTGCTAACGGCGACGGGTGCGGTGCTGAAAGCGCGC
CGGGTTATGCAGTGGTAGGCGACCCACGAGAAAGAATCCGCGTCAGCAGCCGCAGTCGATTTGCCGGCATCGATCAGAGG
CTGCAGGAATGGAGCAGCGGTGTTAACGGGCGCCAAGCAGCCTGGCACGCCGGCCAGATCCTCTCGCGAGTTCGTCAGGG
CATCCCGGCAGATCACGAGTGTACATTTTACGCAGTCGCATTGCAGCAGGCGGCCCTAGTGATGTGGGCATGGGGCACAT
CACAACAGGCTGCAGTCTCGGGCGCAAGCCGGACAGGACCCAGTTGCAACACCGACGAGCCGCATTGTATGTATGTCTTT
GTTGACGGTGTTGAATTTCTTGCTTTTCAGCAATTCCTTCAGCTCGGACAGGGCGAAGCCCGTTGAATAAGGAACGCAAC
AGCGGGTTGTGCATCTTCTTCTGGGCTGGCGGACCGGGGCGCCCGTCAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62