GenePrediction:GLEAN_1974 Details

Name: GLEAN_1974
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2320203..2321679 (+ strand)
Length: 1477
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2320203..2320277 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_144:2320342..2320413 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_144:2320486..2321679 (+ strand)
Length: 1194
>GLEAN_1974 class=GenePrediction position=GCSC_144:2320203..2321679 (+ strand)
ATGGCCCCCTCTACCGGTATCACCATCGCCGCCACGGCCGTGACTACAGCTACTCTTCTGGCCTTCCTGCGATGGGTCCT
CTACCCGCATCATGAAAAGTCGATTGCCAGTCCACTGCGCAGTGTTCTGCCCAAACTAGCGTCCAATCAGGCGATCCATC
TGGGACTACACGCCGGACGCCTTCCCAGGGGCTCGGGATGTCAATACACCAGTACGTTCTAGAATACCAGCCATAGGCGT
TTCTTGAAAGCGATCCTTGCAAAGCCTCTTACATTTGCGTCAGTACGGATCCATACGCGTCTACGAGTTCGGCCCTAAAA
CCGGCCGCAAGGTTCTGCTCGTCCACGGTATTTCCACCACGTGCCAGACCCTTGGCCCCATTGCCCACGGCCTTGTAAGA
CATGCCGGCTGTCGCGTCTTGCTCTTCGATCTTTTTGGCCGCGGCTTCTCTGACGGCGTCGGCGACCTCCCTCACGATGC
CCGCCTCTACACGACCCAGATGCTGCTCGCCCTCGCCTCCTCTCCACTGTCGTGGTCCGGCTACGGCGCCTTCGATCTGC
TCGGTTACTCCATGGGGGGTGGCGTGGCCGTCCCCTTCGCTGCTGCATTTCCACATATGCTTCCCTCTACCATCCTACTT
GCCCCTGCAGGACCCATCCGCCCTGAACGTTTTGGCGTTGCCGCCCGGTTTGTCTTCACCTCGGGGATCGTGCCGGAGCG
TCTATTGGCCGCCATCACGCGGCGGCGTCTGCGACAGCCTATTGCGAGTGCTACCAAGGACAGGTCGAAGTCAGGCAAGG
CACAACCAAAAAAGACACCACCCAAGGTTATTGGCGAGGTGGAGCTTGCCGTCGCTGCCGTTCAGGCTGTCGAGCGCGCT
GTGGAGAGCGCAGTGCAGGAGGCCGTTGACCAGACCGTCGTCCCCATCGATGATGCTGTGGCAGAAGTGGCAGACGCACA
AGCTGCCGAGGCAGAAGAACGGCCACCCGAGACAGGAGGCACCGTGCTCAGCACTCAAGTGATGCGCTATGTGCGTTGGA
TGCTGATGCATCACGACGGATTCGTACCAGCTTTCATGAGCTGCGTGCGCGATGCGCCACTGATGGGGCAGCAGGCAGCA
TGGCAGACGCTGGCGGCCGCTGTTCAGCAAAAAGGCGATGACAGGCTCCCGCTCTGCGTAGTGCTTGGGCACCACGACAA
GGTGGTCAGCGCCCTTGACTACGAGGAAGATGTATTGCCAATGCTAGGCGGACGTAGCGCCGTGACATGGGTCATAGTAC
CGGGGGGGCACGAGTTCCCTATGACCTACTCCCGATCGGTGCTGCGGGCGATATACAGATTCTGGGGTGGGATGGACGAG
GCCTTGGCAAAGCTGCACGAGGACGAAGAGACAGAGGTGGCGGAAACAAAGACTAAGGTTGTGTCGTCTACGTATAACGG
GAAGAAATGCGGCGCAGCGATGGTTGAGGCGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62