GenePrediction:GLEAN_1977 Details

Name: GLEAN_1977
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2332629..2334866 (+ strand)
Length: 2238
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2332629..2332706 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:2332761..2334636 (+ strand)
Length: 1876
Type: CDS
Source: GLEAN
Position: GCSC_144:2334748..2334866 (+ strand)
Length: 119
>GLEAN_1977 class=GenePrediction position=GCSC_144:2332629..2334866 (+ strand)
ATGGCCCCTCCTGTTGCGTTCGACACTATCCAGGTCAAAGACAAGGCACGACGTGACTTGCTGCATCTTCTCGAGGGCGT
GAGTTGGATGGCCACCTCTTGCTCTCACTCTTTCGACTTCTGACATAACCAGGTCCGCGGCAAGAAAAACCTGGTTCTTG
AACAGACCCTTGCTGGACCTATCGGCACAATCGTCAAGGTCTCCACGCTGCAGGATTACGGAGTCGACAAGTTTTTCTTT
CTCGAGAACGGTAATACCGATACTAGCCAGCATAATGTCGTCTTCTTGGCTCGCGGCGAATGCGGCCGTCATGCTCAGGC
GATAGCAGGTGACTATCCCTCTCTTTGCGCCTACTACTCTATGCATGTTAGCGGTGAAAGTGATCAGAGGGGGCTGACGG
TGTTGCTTCTAGACCAGATCCGCCGACTACAACGTGAGAGCCAGACGGGACACGACTTTCACATTATCTGGGTGCCACGT
CGCACACTCATATCGGACAACATCCTGGAAGAAGCTGGAGTGCTCGGCGACGCAAACATATCCGAGCTACCTCTCTACTT
TTTCCCCCTCGAACACGACGTGCTGTCTCTGGAGCTGGACGATGCATTCCAGGACCTCTATCTCCACAAAGACCCGACAC
CGGCATTCCTCCTAGCCAGAGCGCTTATGGGTATCCAGCAACGCCATGGTCTTTTTCCACGCATCATTGGCAAGGGCGAT
AATGCGAAGCGTGTCGCAGAACTCCTCGAGCGTATGCGCCAGGAGCTGCTTGCGGGCGAGGATGCGAGCGAAGCCTCCAA
GCTCGGCCTCACACCTAGCTCCACATCCGAGAGCGTCATCATCATCGATCGGGAAGTCGATCTTGTAACCCCACTGCTCA
CCCAGCTAACCTACGAGGGGCTTATTGATGAACTGTTTGGAATCCAAAACAGTCAAACCGACGTCGATCCCACCATTGTC
GGAGCCGCCGCCCCAAACACTGCCGCTTCCTCAGCTACCGGCGGTACAAGTGGGGCTACATCGTCGGCGGCTGGCCGGAT
ACGCAAGGTTCCGCTGGATTCTTCAGACAAGCTCTGCGAGGAGCTACGGGACGCCAATTTTGCCATTGTCGGCAACCTGC
TCAATAAGACTGCCCGCCGCCTGCAAAGTGATTACGAGGGTAGGCACAACACGCGGACAACGGCGGAGCTGCGCGATTTT
GTTCAGAAACTACCGGGCTTTCAAGCCGAGCAGGCCAGTCTCAAAGTGCATACAGGGCTGGTTGAGGAACTCTACAAATA
CACACGAAGCGACGAGTTCAGCAGCTTACTCGAAGTACAACAAAACCTGGCTGCAGGTGCCGATCCCTCCGCTCAATTTG
ACGCCATTGAAGAGCTCATTGCCCGGGATACATCGCTGCCACATGTTCTTCGTCTCTTGTGCATATACTCAAGTATTTCT
GGTGGTATAAAGCCGAAGGAGTTTGACCAATTTCGCCGGCTCATCCTCGAAGGCTACGGCTACCAACACCTTCTTACGCT
GCAGAACCTGGAGCGGCTACAGATGTTCCTCCCTCGCTCATCGCCGATGGCGGGCATGATTCCGATGACCGTAGGCACAA
ATGTTGCTGGTACGAAGACCAATTACACTTTCGTCCGAAAGCAACTACGACTGATTGTCGACGAGGTCAACGAGCAAGAT
CCGAATGACATAGCATATGTTTACAGTGGCTATGCGCCCCTTTCTGTGAGATTGGTGCAGTGTCTTCTGCAGAAGCAGTA
CCTTTTGAACTTCACAAAGGGCAATGGATCTACGAGCGGGTCGCATGGCTGGCGGGGCTTTGATGAGGTGGTGAAGCATG
TACGCGGACAGACCTTTGACGATCTTCAGAAAGGGGATGACAAGGTTTTCAAGGCAAGAGCGCTTCTGTCGGGCAGTGGA
GCTAAAAAGACCGTTTTCGTTGTCTTTGTTGGTGGTATTACGTTTACAGAAATCGCAGCTTTGCGATTTATTGCGAAGCA
GGAAGCCGGTACGTTCAAATATTATTCCTTCCTTCATTTGACAGACAATTGCCCTGCATTCCGGTTCCTCGTCGTTTCTA
TATTTATTTCCATGCATATACTGATGGGGCATTGAGCAGACCGACGAAATATTGTGATCTGTACAACCTCCATTATCAGC
GGTAATAAGATGATGGCGGCGGCCACTGAGGCCGGATCGTTCGAACGACAAGCCAACCAGGCTGCAGCTGCACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62