GenePrediction:GLEAN_1978 Details

Name: GLEAN_1978
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2336099..2340364 (+ strand)
Length: 4266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2336099..2336721 (+ strand)
Length: 623
Type: CDS
Source: GLEAN
Position: GCSC_144:2336833..2340364 (+ strand)
Length: 3532
>GLEAN_1978 class=GenePrediction position=GCSC_144:2336099..2340364 (+ strand)
ATGGAAGGCTACGAGGACGACGGTCATCATGGCGGTGATGTCTCGGACGACTCAACGCTGTCCGAACTTAGCTCGCCTAG
CGATATGCCAGACGACTTCAAGTATTTCGCTCTATCTCCAGAATACAACTCGATAGAAGCGGCACCTGGCGCAGTGCCAA
ATGCAGGATTGCAGCCAATCGGACCAATTGAGTCTCTAATTGAATCAGCAGAAACAGCAACCGGCAATTTATTCGAGACG
CCAGCGTCACGCGCTTCCTCCGAAGACTCATGCCTCAGCACAGCAAACTCCATGTACAGCCTGGGGGAGGAAGAGTCGCA
CACTGACATGGAGGCATCGATCGAGGATTCTGTCGAGTCGTTCATCGAAGTGTATGCCGAGGAGCCACCTTCTGGTGATG
ACGACGAGCGTGACGAGCCCTCCGCTGAACCAGAAGAGGGGCTGCCAGATGAGGAGCTGCCAGAAGAGCACATACCAGAA
GAGCAGACATTAGAAGATCATGCGGACCGACTAGCTATTGAGCCAGCGGGCACATGCCCCGACGAGGCCACGGAGCAGCC
TGGTGACAAGCCTACTAAGTTGGAGCCTGAGAAGGCGAGACCACTTGGTCATGTGGTACCATCGTAAGTCTCGCCGGCCA
TTTACACCCGAATTCTGCTTCGTACGTCTTGTAACGCTGACCGTCCTCTTCGCAGACCGGATTCATGTCATCACACATTC
CCGTCGTTACTCAGACTGCCTCCTTTGCGCGAAAGCGTACACAAGTCGCTTGCCTCGTCGGTGTCTGCCATTACCGATCG
GTCGGAGCTGTATTCAATCCCGTCGCTGGCATCCAGCTCTAGTAAGGCCACAACACCAATCGACTCGGACATACCGCTCG
ATGTATCGAACCCGTCACCGCAGCTGTCCTCGGCACCCGCAAGTATGCAAGCTCCTTTGCCGCAATCACTAAGGAAGCTG
TCTCTCTCACTTCTTCCCGACCTCCAGCCTCCCCAGTCGGCAGTGGTGCATCTGCAACATACGATTTCCTCACTGGCTTC
AGTTTCTCAGCTTCCTGCTTCTCCTGTACCCACATCGCCGAAACCTTCCCTCCCAATCCGAATTGTGCACAAAGTTCGGC
CCAAGTCATCCATCCCGGCAGACCTGTCCGCGCGGGAATACGCTAGACAGTGCGTGGCTGCCGCTGAATCGTCCAGACTC
AATCCATATGCTTTAGACGAGGAGGAGCGGATGATACTGCGCCAGCACATCAGCCACGCACAGGTCACCACGTATCTGAA
CATTCGCAACGGCATCCTCCGGCTATGGGTACGGCGACCCCAGGTTGCTGTCACACGGCAGGAGGCTATAGGCTGTGCAA
AGGATAATCGGTGGTTTGACGCAGCCAATGTCTGTTTCCACTGGCTTGTCCGTCGTGGCTTCATCAATTTCGGATGTGCG
CAGATACGGGGAATCCAAGCCAGCGTTGCTGACAAAGTAAAAGACAACGCCGGCGGTAGCAGTAGCATGCCTTCCGGAAA
GCAGCAGCGGAGAAAACGGATTATCGTAATTGGTGCCGGCTTGGCGGGTTTGGGCTGTGCACGCCAGCTGGACAGCCTCT
TCAAGCAGTATACCAATAGGTTCCTCGAGCTAGGAAAGCAGCCCCCGCCGGACGTGGTTGTCCTGGAGGGACGCAGTCGA
ATCGGTGGCCGGGTGTACTCGCGACCATTCCAGCAGCAGCAGCAACCGCAGCAGGGCGAGGCAAAGGAGGAGGGAAACGA
GTCCGGCGAGCGTCCTGTATTTCGCTGTACTGCTGAGATGGGCGGCATGATCATCACGGGGTTTGACCGTGGCAACCCAC
TGAACGTCCTGGTCCGGGGCCAATTGGGCCTCCCCTACCACGCACTGTGGTCAGAGACAACAATTCACGACACAGACGGC
AAACCGGTCGATAGCCGGCGTGATGGATTGGCGGAAAACCTGTTCAACGAGTGTCTTGACCGTGTCAGCGAGTACAAGTT
CAAGACTCCGGTTCAAGCACCGGTCGAAGGCAACCGCGATCTGATGGATGAAGGCCGCGACAGCTCCAGTTCGGCAGAGG
GACACCGGATGATCGCCCAGGTGGAGGATGCACAAGCAGCAACAGCGCAGGCGGCACGGACTGTCCAAGCCGTGGCGACG
ACGGCAAAAATGGCGCAAGAAGCAGTGGCACTCGCAGCGACCCAGCTTGAGACTCTGGCGGCGAAACCATCGGCCCAAAA
GGCGACAATCCTGCCCCAGAATGGGCTCTCTGTCCTGCCGGCTCGTGGCACGCCCGGAGTGCCAGGAGTCTTGCCGGCTG
CTTACAAGGTCCAGAAGATGGGCTGGGATCTAAGGCCTGGCGTGGTTGAGTCTCGAGACCTCCATCTAGATGCAGCTGCA
AAGGCACCGGGCGCCACACTGGGCTTCGTAATTGACGAGGCCATCAGACAGTATCAAGAGATGGTTGATTTTGGCGCCAA
AGACTTTCGGCTGCTCAACTGGCACATTGCCAACCTGGAATACAGCACTGCTATCAATCATTCCCGTCTCAGCCTCCAGG
GGTGGGACATTGATGCCGGAAATGAGTGGGAGGGAAAGCACAGCAGGGTGATTGGCGGCTACCAGAGCGTGCCCCGTGGG
CTGATGCTGTGTCCCACGCCTCTGAATCTGCGTAGAAACATGATTGTCACGAAGATATCCTACAGCCTGGACACAGGCGG
CAGCAATGCTACTGGCCACAATGGGTGGGAGGAGGGCAGTGCGCCCGTGATTATTGAGTGTGAAGGCGGGTACAGCTTCG
AGGCGGACTATGTTGTGAACACCATTCCGCTTGGCGTTCTCAAGCACGGCAACGTGGAATTCGAGCCACCGCTGCCAGAG
TGGAAGACTGACGTGATACGGCGGCTGGGCTACGGTGTGCTGAACAAGGTCATATTGACGTTCCCACGTGTTTTTTGGGA
CCCCAAGTACGACATATTCGGGGTGCTGCGCGAGCCGAGCAACGGGTCCAGTCTCGACCAGCAGGACTATTCGCGACGAC
GCGGGAGCATGTTCCAGGGGTTCAACGTGACGACGACGACGGGCCTGCCGTGCCTGCTGGCGCTGATGGCAGGCGATGCG
GCCTACGACACGGAGACATCATCCAACGACGAGCTTGTGGCCGAGGCAATGGCGGTACTGCGCAGCGTGTTTGGGGCAGA
GAAAGTGCCGGCTCCGGCCGAGGCGGTTGTGACGCGCTGGGCCAGCGACCCATTTGCGCGCGGGAGCTACTCGTCAGCCG
GGCCTGAGATGCGCATCGACGACTACGACGTGATGGCGCGGTCGGTCGGCCGGCACCTACTTTTTGCCGGCGAGCACACA
ACGGGCGCGCACCCAGCGACGGTGCACGGAGCCTATCTATCGGGGCTGCGAGCGGCATCGGAGCTGATCGAGGAGCTGCT
GGGACCCATCGACGTGCCAGTGCCGCTGGTGATACCGCGGGAGATGGCGGCATCGCTGAAGCGCAAGGCAGTGCGGGAAG
AGGAGGAAAGTGCCGGGGGAGGGGCCACGGGCGACGAGAGCGGCAGTGGAAGCGCGGCCGGAAAGGGCGGAGCGAGTCTG
GGCAGCAGCCACAGAGCGGTCAAGGCACGTCTGCGGCGGCGGATGGAGGAGCGCGAACAGCAGATGGAGAAGTATGTGCA
GGCGCATATTGGTGAGCGGCCGCTGCAGCCGGCGCGCGTGGTGGACACGTCGTATCTGCTGTTCAGCAAGGCGAACTACG
AGCGGGCGCGGAAGAAGTGCGAGGAGACAATGATGAGTCGGCGCAAGGGTGGCAGCGGCAACGGCAGCGGACTGTCGAGC
GCGCGGGCACTTCCCAACGACGTGCGGGTGTTGACGTCTAAGATGTGGCGCAGCGCAAGCGCTGACGAGCGGCGGCCGTA
TGCTGAGCGAGCGTCTGCTGAGAAGCAGGCATATGTGGCAGCACTGGAACAGCACAGACAAGAGGCAGCCGAATGGGACC
GACAGGCGACCGTGCTGCGGTCGACCTTTGCGGCCGAAAACTCCGATCCGACGGCCACTGTGGCTTCGGCGGTGATTGCG
GCTAGCAGTAGCAACAGCAACAGCAACAGCAACAGCAGAAGTAGCAGCAGCATGGAGCAGATCGCCCGGTCACCCTCGGC
GATGACGTTGGACAAACCAGAGCCTCCTGCAGTGCCGCGACGGTTGCGACGGCTGACGAGTCAAGCCATGGATGCAGACA
ACAGCGACGTCGACATGACGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62