GenePrediction:GLEAN_1979 Details

Name: GLEAN_1979
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2342965..2345904 (+ strand)
Length: 2940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2342965..2343016 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_144:2343212..2343375 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_144:2343563..2345704 (+ strand)
Length: 2142
Type: CDS
Source: GLEAN
Position: GCSC_144:2345764..2345904 (+ strand)
Length: 141
>GLEAN_1979 class=GenePrediction position=GCSC_144:2342965..2345904 (+ strand)
ATGTCAGATAGCTCGGATGATGACCGGCCTCTGGCAAGATCAAATGGACACGGTTAGTTCTTTAATTCAACTGCAATCCC
TCTCATAGCTTTCTCACTCTTTTCGCACCGCGCCGATGACTTATCTCTTTCGCCATTCCATTTCGTCTCCCTTTTCTCTT
CACTCGCCGCTCATCTTTTATCCTTATCCTCCGTTGTGGTCTATCTATCAGCGCCGAACGTTCTGACGCTCCAAATTCTT
CTCTCAGGTTCCAACTCGACCCCGAACATGGCCGTCACCAATGTGACTTCTCGGAATGGTCCTGCCAACGGAGACCATGC
CAACGGTATAGCCAAGCGGAAAGCCCGTATTTCTCTTGATACGAAAATAAGCTACAAAGACGAGTCCGACAGCGATGACA
ACGCTCCTCTGGTCAGCTGCCCTATAGTACCGCGAATGTCGCCTACTTGGCCAAGGCCTGTAGGTTAGCTGAGACAGTTG
GTCAACTAACAGTTTTCATCAACAGGCAAAACGAAAAAAACCAAATCACGTTGAACTCGACAGCGAGGACGAACCAGTTT
CTTCAAAAGCAAAACGAAAGCCTCTACCGTCCACACAGGACACGCCCATGCTCGACTCGGACGACGATAAGCCTCTTAGT
GCTAAAGTCGCTAAGAGGGCCAGCACCGTGGTAGCGAGACCGAAACCCAAAGCATCTGCATCCTCGAAAAAAGCAAATGG
CGTGAAGCTTAAGGAAGAATCAGACTCGGACACCCCCATAGCAAAGAAGAAGATTGTCAGCTCATCCAAGCCCGCGGTCA
AGCCTGCAGCCAAGTCATCACGACCGCCAGCCAAGTCAGCCCCCACACCAAAGAAGGCTGTAGGTGCCAAGGGCCTAAAA
AAAGAGGAAAGTGCCGACCTCGGTGACCAGGAGGCGGAAGGACAGGACTATCGTTGGTGGGACCAGCCAAAGAAGGAGGA
CGATAGCATCAAGTGGACCACGCTGGAGCACAACGGTGTTGTTTTTCCGCCTCCAAACCAGTCTCTGCCGAAACATGTAC
GCCTCTACTATGACGGTGCACCAGTCGAGCTCCACCCCGAAGCGGAGGAGGTTGCTACGTTCTTCGGCTCTATGCTTCAC
TTGACTGTCAACACGGAGAACCCGACGTTTCAAAAAAACTTCTTCGCCGACTTCCAAGAAGTAGTTGAGAAGACAGGCGG
TGTAAAGCGGCTGGACGGGAGCAAAGTGGCACTGCGTGACTTCACCAAACTCGACTTCAAGCCCATGTTTGAGCACTTCA
AGGGCTTGACCGAGGCCAAAAAAACACGATCCAAGGAAGAGAAGAAGGTGGAGAAGGACGAGAAGGCGAAGCTAGAAGCC
CCATATCTCTACTGCAAGTGGGACGGGCGGAAAGAGAAAGTGGGCAACTTCCGTGTGGAGCCTCCGGGTCTGTTTCGTGG
TCGTGGTGAGCATCCGAAGACGGGCCGGGTCAAGAAGCGGGTTGCTCCTGAGCAAGTGACAATTAACATCGGCAAAGACG
CTGCCGTTCCGATGCCGCCCCCTGGACACAAGTGGAAGGCAGTGCAACACGACAATAAGGCGACATGGCTGGCTATGTGG
CAGGAAAACATCAACGGATGCTACAAGTACGTCATGCTTGCGGCAAACAGTGCAATCAAAGGCCAAGCCGATCACAAAAA
GTTCGAGAAAGCTCGCGAGCTGAAGAAGCACATCACCCGCATCCGTGCAGACTACACCCGAGAGCTAAAGAGCGAGGTTA
TGGCTGACCGCCAGCGTGCCACCGCCATGTATCTCATCGACCGATTCGCCCTGAGAGCGGGCAATGAGAAGGATACGGAT
AATGAAGCCGACACGGTCGGTTGCTGCTCTCTCAAGTATGAACACATCACACTGAGAGAGCCGAACACAGTGATCTTCGA
TTTCTTGGGAAAGGACAGTATACCGTATTACGACGAGGTGACTGTGGACCGGCAGGTTTTCAAAAATCTCAAAATGTTTA
AGAAGCCTCCCAAAGAGGATGGCGACGACATCTTCGACCGACTAAACACCTCACAATTAAACAAGCACTTGTCAAGCTAC
ATGCAGGGCTTGACGGCGAAGGTGTTCCGTACCTACAACGCCTCATATACCATGTCAAAATTGCTCCAGGAGCTGCCGGT
GACTAGCCTGTCGATCGCAGAGAAGGTCAAGCTATATAACGACTGCAACCGGAAGGTGGCTATTCTCTGTAATCACAAGA
GGACAGTAGGCGCAAGCCATGAAGCACAGATGGAGAAGATTGGCGACCGCATAAAAGGCCTCAAGTATCAGAAGTGGCGG
ACGAAGATGATGATTTTAGATGTCGATTCCAAGCAGAAGAAGAAAAGGGGGGCCGAGTACTTTGAACTGGACTCAGACAT
CAGCGACGAATGGGTTCTCGCACACCAAGCATTTCTCGTCGAGGAGCAGCGTATTAAGATCACCAAAAAGTTCGAGAAGG
ACAATGAAAAGCGGGTGGCCGAGGGCGACAAACCGCTACCGGAGAAGGATCTCAAGGAGCGGTTGAAGGCTCTGGGCGAA
CTGGAGGCCAAGTTCAAGAAGGAGAATCGGACCAAGAAAGTTGAGGCCGAGGGAAAGTCCGCTTCTGTGGAGAAGCTGGA
AGCCGCTGCTCAGAAGATTGACGAGCGTATCCACAACATGGAGTTGCAGGCCGCCGACAAAGATGGAAATAAAGAAGTTG
CTCTGAGCACGTCGAAGATCGTAAGTCTATACTCTCTGAAGCTCTTGTTGGCCTGCATTACTAACACCAAGTTATACAGA
ATTACATTGATCCTCGTCTCACTGTCGTATTTTCCAAAAAGTTCGATGTTCCCATCGAAAAGTTCTTTTCCAAGACGCTC
CGGGAAAAGTTCAACTGGGCCATTCATTCCGTTGGCGACGACTCGACCTGGGAATTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62