GenePrediction:GLEAN_197 Details

Name: GLEAN_197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:163106..164271 (+ strand)
Length: 1166
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:163106..163638 (+ strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_167:163752..164271 (+ strand)
Length: 520
>GLEAN_197 class=GenePrediction position=GCSC_167:163106..164271 (+ strand)
ATGGCTGACGACGCTCCCTTCAGCTTCCTGCCGCTCGGCGCCATCATCCAGCGCTTCGACGTCGACGGCACCAACATCGT
CCAGGGCTTCCCCACTTCCGAACTGTATGCCTCCCACAACGCGCCCTACTTTGGCGAGACGATCGGCCGCGTGGCCAACC
GGATCAGCGGCGCCCAGCTACACAACATCAACGGCAGCGCCGACTGTCCGCTGACCGCCAACGACGGGCCCAACGCTCTG
CACGGCGGCCCTGCTGGCTGGGGCAAGAAGACCTGGACCGGACCTTCGCCCGTGGGCGTGCACACACTCTTCCCTGGCTT
GGCCCCGCTGACCGAGGGCGGCGAGTCGGTGCGGTTCACCCTCGACAGCCCCGACGGCGACGAGGGCTACCCCGGCAACG
TCCTTGCCTCCGTCACATACACGGCCGGACGTCAAGCTGAAGACGACAAACGGATCACCGTACTGGTCATCGACTATGAG
GCCGAGCTGGTCGGCAATGCAGACGAGACCGTCATTAACATGACCAATCACTCGTGAGTGTGTTTTTGTTCTGATCTGCT
GTTCTGCTGTTCTGCTGCTATTGCAGTTGATTCGGCTTCTATTCATTTGATCCCCTTCTGATTCGCCATCTCTGGCACCT
GTACAGCTATTTCAACCTCTCTGGCACCACATCCATTGAGGGCACCGTTGTCGAGCTCGCCACCAACAGCTACCTGCCTG
TCGACAGCACCGGCATCCCCACCGGAGGACCCGTTCCTTTCGCAACAGTGCCGCCAGCACACACCTCTTTCGTCTTCGGC
GCCACGGCTCCTGACATTGACGACTGCCTCGTGGTCAACGAGGAGCCCTCATCGGTGCCTATCGATACGCGCAGCTCGCC
GCTGGTCCGTTTCCTCACCGCCCACCACCCTCAGTCCGGCGTCCACCTGGAGGTCTGGAGCACCGAGCCGGCCTTCCAGC
TCTACACTGCCGGCTATGTCGACTTGCCCCCTCTCGGCGGTCTGCCAGCTCGCGGTCAGCGCTGCGGCTTTTGCGTCGAG
CCCAGCCGCTATGTCAATGCCGCCAACGTCGACGCCTGGCGCTCGATGGTCCTGCTCAAGCGCGGGGCCAAGTATGGCGC
TCGCATCGTCTATCGGGCCTGGAAGGATGCGCAGAAAGAAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62