GenePrediction:GLEAN_1980 Details

Name: GLEAN_1980
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2352108..2354045 (+ strand)
Length: 1938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2352108..2353733 (+ strand)
Length: 1626
Type: CDS
Source: GLEAN
Position: GCSC_144:2353791..2354045 (+ strand)
Length: 255
>GLEAN_1980 class=GenePrediction position=GCSC_144:2352108..2354045 (+ strand)
ATGGCACAGCCTGCAGCGGCCAGGACTTTGTCCCGGACGGTTCTGCCCCGGCCTGTGGTGCCTGTCACCGCTCGTTCAAT
GTCCACCTTGCCAAGACTTTACCGAGCACGCACAGGATTGCGTCCGCGAGTCCCTTTATGCAACAGGTTCGAGCTCGGTC
GGTGCCGTGGGTTCCACAGCAGTTTGAGCTGCCAGTCTGCAGAAGGCGAGTTGGTGACCGAGGCAGCCACAGGGGAGACT
GGGACGAGCAGCAATACAGCCTCGAAGCCGCCGGCGCCACGCAGGATCACGATCGAGGACATATATGCTCGGCGGAAGCG
AGACGGGCGGCTTGTGGCCGGCACGGCAGCAGCAGCCGACATCGACTCGTTCAAGACGGCGTCAGACTGGCAGCTGCTGC
CCAAGGCGCGGCGGTGGGACCACCTGCTAAGCTCGGAGAGCAGGGCGCGTGGGCCATGTGTGTTGAAACAGGCGGCGCAA
CACCTCAAGAAGCCGGGCATGATTTCACTGGGAGGCGGTCTGCCAACGCCGGAGCACTTCCCCATCCAGTCACTAAGCCT
GCGGGTGCCTACGGGACCGACTGACTTCTCCGAGACCGCGGCAGGGTCTGAAGATGGCGGGGCGACGGTGACGATGGGCA
AGTACGACGCGTCGTTGCGTGCAGGCAGTGGCGGAGAACCAGCAGCAGAGTACGACCTGTCGGTCGCGCTTAACTACGGA
CAGGCGGCCGGATCGCCACAGATGCTGCGGGGGGTGACAGAGCACACGGAGCTCGTCTGCCGGCCACCGTACGCGGACTG
GCGCACGACATTGACAGTGGGCAGCACGGGAGCACTGGAGCAGGCACTACGCATCTTTTGCGAGCGTGAGCGCGGCGACA
CGCTGCTGACGGAGGTGTACAGCTTCGCAACGGCGCTGGAGACGGCGTGGCCGCTGGGCATCCACGTGCAGGGCGTGGAC
ATTGACGGCGAGGGCATGCGGCCGGACAGCCTGGACGCCCTGCTGTCCGGCTGGGACGTGCAGGCCCGAGGTGGACGGCG
CAAGCCACATCTGCTGTACACGGTGCCCAGCGGGCAGAACCCGACAGGCACGACGCAGAGCCTGGAGCGACGACAGGCGC
TGTACGACGTGTGCAGGCGACACGACGTGTTCATCCTCGAGGACGAGCCGTACTACTTCCTGCAGATGCCACCGTATGTG
CGCAGCCGGGACGCTGCAGCGGCTCCGGGGCCGGGTGACGGGCAGACACCGCCGTCTGCCGAGGCGTTCCTGCAGTCGCT
CATCCCGACCATGGTGAGCCTCGACGTCGACGGCCGGGTGATGCGCTTGGATTCGTTTTCCAAGGTGCTCGTGCCGGGCT
CGCGCATGGGATGGGTCACAGCGTCGGAGCAGGTTGTCGAGCGGTATGTGCGGCACAGCGAGGTGTGCAGCCAGGGTGCA
GCGGGCATCTCGCAGGCGGTTCTCTACCAGCTGCTAGAGACGACCTGGGGCCACGCCGGATATCTGAACTGGCTAGCCCA
CCTGCAGCGGTCGTACACACGTCGCCGCAACGTCATGCTGGACGCGTGCGAGGACTACCTGCCGACGGGCATCGTCACGT
GGAAAGTGCCGGTTGCCGGCATGTTTGTGAGTTCAGAGTGTTCCCCGTTGTGTCTGACGACTTGTCTGACTTTGTCTGCA
CAGCACTGGCTCAAGGTCGACCACACGCAGCATCCAGACCACGGACGGCGGGACGCGCTCGAGCTGGAGGACGAGATCTT
CAAGCTCTGCATCGACAAGGGTGTCCTGGTTGCTCGGGGATCGTGGTTTTCAGCCGAGCCTGACAAGCCGCAGACGGGAC
TGTTCTTCCGCACGACATTCGCTGCAGCCCCGCCGGATGCGATAGTAGAGGCCATCCGCCGGTTCGGCGAGGCCGTCAAG
CGGAGCTTCCGGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62