GenePrediction:GLEAN_1981 Details

Name: GLEAN_1981
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2360482..2362175 (+ strand)
Length: 1694
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2360482..2360858 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_144:2360933..2361917 (+ strand)
Length: 985
Type: CDS
Source: GLEAN
Position: GCSC_144:2361999..2362175 (+ strand)
Length: 177
>GLEAN_1981 class=GenePrediction position=GCSC_144:2360482..2362175 (+ strand)
ATGCCTGTCGAGGTTGCTATGAACACGCCGTTGGCAGAGGCGCTGCAACGCGAGATTCAGCCGAAGCTGGTGGAGTGCGG
ATGGGCGCCCAGCGATGCCAGCGATACCACCATGGCCGAGTATCTGATCTTGATGATCGTCAATGGAAAGACTGAGGACG
AGATTGCTTCGGAACTATCTAGTGATCTTTTGAACCTCCCACCCGAAGATGACAGCGCAAAGCAGTTTGCACGGTGGTTG
TTTGAGATAATCGAGTCAGAGAACGCTAGAATCAACGGCTCGGGCCAACAACAGCAGTTTGAACTGGCATTTTCGGGCGG
AGACCAGGATATGGAAATGGACTTGTCTAGTGCTGATGCACTAGGCAGCATGATTGCGTGCGGCTCCCCTCTTTACCTCG
GTCCTTTTACTGGACACCCTTTTGCTATTTACCAGTGCTGACCTGCCACAGACCATCGGGACCGAAAGCGATGCGAAATG
GGCCCGGATTCCGCGGCGGGCGGGACAAGCGCATGCTTGGCCAGATCAACCGCAATTTGGACCGTTCCAATGACTCGGTT
CTGCACCGTGTTCGCGGTACCGATCGCATCAGCACACATACGCGCGGGGGCGGCGCGGGACCGAGAGGGAGTGGCGGCGG
GTTTGGCATGGGCCGCCAACAGCGAAACATGAACGGGAGAAATGCTTCTGGTTTCAACCAGCAAGCCATGGCTGCCGTCA
TGTCTGCCGGTGGCCCGCAGCCGGGCATGTCTTGGATGGGCCCACCGGGCCCGCCAGGCCAGCCGCCGATGCAGCCGGGT
CCCATGGATGTATACGCCATGTTGGAGCAGCAGTCACGTATGATGCAGCAGATGCAGGAGCAAATGCAACAGCAACAGCA
GCTGATGCAGCATGGCCGACGGGGCGGCTTCAATCAGCAGAGTCGTGGCCGGCCACTGGCAGACCGGATACAACACCCGA
ACCAAAACTACAGGAACAACATGCGGAATGGGGGTCAAAACAATCATGGCCAACAGGCTGAAAATGGAGGGGAAGCACCA
AAATCGAACGGCAAGTCGCAAGAAGGCGGCGACGCTTCCGGCTCGGCCACGGGAGAGGATGTCGACATGGGCAGCGAGGC
CGGCACACACCGCGAACCGTTGAACCCGACTGATACGGTGTGCAAATACAATCTCCACTGCACGAACAAGGACTGCAAGT
TTGCGCATCAGTCACCGGCAGCACCCCCCGGCACCACGGTAGATGTGCTTGACGTTTGCACGTATGGTGCTGCCTGCAAG
AAAAAAAAAGTGCGTGGCGCGGCACCCGTCGCCAGCCGCCCGGATGGCGCACCAGAGCGAGCAGGACTGCAAATTTTTTT
CCCAACTGCGCGAACCCACACTGCCAATTTCGGCACCCGTCGATGCCGCTGTGCCGCAAACGGAGGTGACTGCGCGGTTC
CGGGTTGACAAGTTTACGCACATCAAGACATTGTGCAAGTACCGTCCGTGCACCAAACCGATACTGCACATTTCAAGCAC
GAGGAGGGCCAGCGAGGCGTATTTCCCGACAAGGTGTGGACGGCGGATGGTGCTGGCAGGGACCAGCAGACGCACATCAG
CGAGCGGAAATTCGTCGACGAGACGGCCGCAGAGGAGACCATTCTTCCAAGTGCTGACAGGGACATGACCAGCGAGGAAG
CGACGATCGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62