GenePrediction:GLEAN_1982 Details

Name: GLEAN_1982
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2363066..2364176 (+ strand)
Length: 1111
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2363066..2363092 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_144:2363166..2364176 (+ strand)
Length: 1011
>GLEAN_1982 class=GenePrediction position=GCSC_144:2363066..2364176 (+ strand)
ATGGCACCTCTCAATGCGCAGTCAGTGGTTCGTCCGCTTCTTTGGCGAACTCGCATCTACTACTCTTCAGTGTGCTTGCA
AATACTGATCTCGACGCCAGGCTGCTGTTGCCCGGCTCCGTGCTTACCGGTCCCCTGCCTTCCCCTTGTGGAACCGGCTC
CCTCTCAGTCGTCGGGCCGCCGTACTCATACTGCTGTATGCAGACCGCCATGGCGACTTGCGCGTTGTCTTGACCATGCG
AGCCGCCAGCCTGCGCAACTATTCGGGCCATGCGGCGTTTCCGGGTGGCAAGGCCGACACGCTGGACGAGACACCAGAGC
AAATCGCGCGGCGCGAGGCGTGGGAGGAAATCGGACTGCCACTAGACGGCCGAGGGATACTTCCGCAGCAGTTCCGCATC
GAGCACCTATGTAGCCTGCCCCATAACCTGGCCAAGACAGAGCTGGTAGTGCGGCCTTGTGTTGCGCTGCTGACCGCTGA
GAGAGACACGGCGGAAGCTGAACGGACAGAGGATCTCCAGAGCGAGGACGCGCGAAGCATAGACGTCGAGAGGCTCATAC
CCCGGCTGGACGCTAAGGAAGTGGCAGCCGTGTTCAGCGCGCCGTTCCACAACTTCCTGTTGGCGACAGACGAGCTGGAG
CAGCCGGAGAAGGACAAGGTCATGGCCGAAGCGAGTGGCAAGACACAACGACTACGGCCACGACTACCGTCGGGGCCCTG
GTACGAGGGTGTATGGGTTGACTGGCACGAGACACCTTGGCGGATGCATTACTTCTACGTACCGGTTGTGGGCCAGCGGG
TGGCAAAGCCCAAGAAGCGATTGCGAAGCAGTAGTGCCGGCAAGGCTGCGCCGGCGCAGCAGCAAGAGGCTAGCAGTGGC
GACTACGACGACATCGAGGAAGCACCTGGGCGATACAAGGTATGGGGAATGACAGCGCGCATCCTTGTGGACGCGGCTCA
GCTGGCATATGACGAGCGGCCTGAGTTCGAGCACAACGCCCACTTTGGTGACGAGCGCATCCTCGAAGGCCTCGAACAGA
TGGGGCGGCTGGGCGAGAAGCTACGGAAAGAGCTGACCAATAAGGATGCCAAGGATGCGAGCAAAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62