GenePrediction:GLEAN_1983 Details

Name: GLEAN_1983
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2366080..2366774 (+ strand)
Length: 695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2366080..2366111 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_144:2366174..2366249 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:2366331..2366774 (+ strand)
Length: 444
>GLEAN_1983 class=GenePrediction position=GCSC_144:2366080..2366774 (+ strand)
ATGCTCGCATCGCCAGTAAATCTGCCCAAGTGGTATGTTCTGTGGATGCAGATGAACCCCCCTGGCCAAAAGAAAACTGG
CTGACAATCAGTAGGCTAGATGAGAACTCGCACTTGTTGAAACCGCCTGTCAACAACTATTGTGTCTACAACGAGGACTT
CACCGTAATGGTGCGTTTACGAATCTATGAGTCCCTGACAGGTTCCTATACTGCGCTGTGTGCCGCCTATTGATTCTCGC
CTGATCTGTAGATCGTCGGTGGCCCTAACGCCCGTACCGACTACCATATCAACGAGACACCCGAGTGGTTCTACCAGTAC
AAAGGTGCCATGGTGCTCAAGGTTGTCGACACGGACGGCAGCTTCCGCGACATTATCATCCGTGAGGGTGACATGTTCCT
GCTGCCAGCAAACACCCCCCACAACCCCGTGCGCTTTGCCGATACCGTGGGCGTCGTGTTGGAGCAGCGGCGGCCTGCCG
CATCCACGGATCGGATGCGTTGGTACTGCGCCCAGCCCCAGTGCCGGGCCATCGTGCACGAGGCTGCCTTCCACTGCACC
GACTTGGGCACACAGATCAAGTCTGCTGTTGAGGCCTTTAGCAGCGATACAGAGGCCCGGATATGCAAGACGTGCGGCAC
TTTGGCCGACTGGGCCCCGCCGCTGGGCTCCATTGCAGATCCCAACAGGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62