GenePrediction:GLEAN_1984 Details

Name: GLEAN_1984
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2368888..2371306 (+ strand)
Length: 2419
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2368888..2368895 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_144:2370449..2370539 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_144:2370620..2370699 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_144:2370856..2371306 (+ strand)
Length: 451
>GLEAN_1984 class=GenePrediction position=GCSC_144:2368888..2371306 (+ strand)
ATGGAGAGGTAAGAAAGTACCATCAACTTCCGATTGTCTCATGCTTACAATCAGACTGATACCGACATTGATCGCGCATC
GGCGCTTCTGGCACTATACGAGCTTCGCGCCAAGCTGAAACAGTACAACGATAACAACAGTCTTCAACTGGCTCGCGAGA
AGATTTTCACCTTATCTACACAGAGGCAGAAACAGCAAAATACATATCAACCTAGCAAAGGGACTGCACCATCCACTCCA
GTTCTGCAACCACCTTCTCTCGGCCGACAATATACTCAGTACACACACCCACACATAAGCTCGAAGTTACCACAATCCCC
ACCCCACCGCTAAAAGAAAAGTCACAAACAACGCAAGGAGTAACGGTGCAATCTCATAGCATATCGGGAAACCGTAGTGC
TTTTTTCAACGACCAGTGCATTGACCTTTGATGGCCGTATGCACAAGATCACGAAGTCTATGCTCGAACTATAACAAAAT
ATCTACTCGCTCTCGCACTTTCATAGGAATCTGCTTTAGGGAAGATTTGTGAACTTGTTCCCCCCCTAGCAACCTTTGTT
CTCCTCTAGCTATGTGCAGAGAATTGGCAATGTATCAAAGTGGTCAAGACCAACTTTGCAGCCGTTGCTCTCGCTATTTT
CTTGTGCCCCTTAAAAAACTAAAAGGAGATGGCGTTCTTGGGGTGCTCCTGATAATAAGGTTAGTCAAGCGAGTTATAAA
CCCACAGTTGACATAAATGAAAGTAAATTTGCCGGTGCTTAGTGAGTTTCGAGAAGAAGAAGCGCTTTATATCACTGGCC
TTTTAAAACTGGCAGTGCGCTCTGCTCCGGAAATAAGCATCGAGTGCCTTCCGCCTTGAAGTAAGCTATCTTATCTATAA
ACTCCCGCTTTCTAAGAGATGTGGCTTCTACTCCGTGTACCACTAGTCTGTACGCGCAGTCGTCTGCGCAAATACCAGTG
TAAGACCCGTACGGTAATCCTTGTGGGATATTCGTCCGGACCAGTTGCACGTATCGTAGTAAGCTCTAAGGCCTTTCAGA
AGATCTAGTGATGATATTTCGTTGGGTGGTTGACTGAAGCTTTAGACTGTGCGCAATGTGCGTCCAGTCAGGGCTTCGTC
TTATCTAGTGATTTCGGCGGCCGAGGTCAGGTGACCTCGGGAAATCCACAGAGAGCTTCGTACTTGAGAGGCACGTGACC
TTGCCACAGGGACCCAGTCACGCGTTGGTGTGCAGCGTATTACTCCGTATTCCGTATATTAGAATAACCTGGCTTTTGGA
GATTTCGCTAAAGTGACCGGCGCCGACCTTCAAATCTTCACACTTCCTTACTCTCCTCTTTTGAGGTGTCTATACCGGAA
GTCTAGACCGATCACTTTACCATATTTACCATGGCCACAGGCGTGGATGCTAAGCTCCTCAAGAGCACGAGGTTTCCACC
TATTTTCAATCAGAAGGTAGACATGCAAAAAGTAAACCTTCAAGTGATGAAAAAGTACGTCTAAGCTTGCGCTTCGCTTC
TCGATCCGTTAACTCACCATGCTAACGCATCTACATCACAGATGGATTGCTGGAAAGATTGCCGCTATTTTGGGCAACGA
CGACGATGTTGTGATCGAGCTCTGCTACAATCTGATCGAGAGTTCAAGAAACGTACGCGCCACCACCCTTAAATCCTTAT
ATATCTGGCCCTTCTCCGAATAAAGCTCGCTAACGCGCATTTGTAACATCAGCCAGATATCAAGGCACTCCAAATTCAGC
TCACTGGCTTCCTAGAGTCGGAAACGCCTACTTTCTGCAACAATTTGTGGACGTTGCTACTGAGCGCCCAATCTAGTCCG
CAAGGGATCCCACGAGAACTTTTGGAAGCTAAGAAAATGGAGCTTATTCAAGAAAAGGTGACATGACCCACAGTCCGATT
TGAACAGCAAAGAAAAAAAAACACCTAGCTGACAACCGGTATTACCAGATCGAAGCCGAGAAGGCCGCAGAAGAATCTCG
CCGAAAACACGAGGGCGGCGGGCGTTTTGACCGCCCGCCTCGAGGCGACGACCGTGGCGATACCTGGCGGGGTGGCGCTG
GTGGTGGGCGCCGTGGCACGGAAACACAAAACGGAGGAGGAGGAGGAGGCGGAGGAGGAGGTTGGGGCAGGGACCGTTCT
CGTTCACCTGCCGGCCGCGGACGTGATTTTCGTGAACGGGGCAGATTTCGGGCAAGACACGATCTCTACGTTCCCAGTGA
TCGTCGTGGCCGCGGTGGTCGGCGAGACGATGTCCGGCAGAGGAGGTCGCCTAGTCGATCTAGCTCCCGATCGCACTCAC
GATATCCGCAGCGGTCTCACTCGGACAAATCGACGTCTCGTTCTCGCTCCCGTTCTCATTCCCACTCTCGCTCGCGCTCC
CCGTCACGGCGCCGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62