GenePrediction:GLEAN_1986 Details

Name: GLEAN_1986
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2372699..2376673 (+ strand)
Length: 3975
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2372699..2372824 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_144:2372878..2373271 (+ strand)
Length: 394
Type: CDS
Source: GLEAN
Position: GCSC_144:2374024..2374127 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_144:2374185..2375982 (+ strand)
Length: 1798
Type: CDS
Source: GLEAN
Position: GCSC_144:2376044..2376246 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_144:2376512..2376673 (+ strand)
Length: 162
>GLEAN_1986 class=GenePrediction position=GCSC_144:2372699..2376673 (+ strand)
ATGGCAGACAAGCCACACAATACAACCGGCGTTGTGGCCGATGTACCGGGATTACCTTACTATGAAAAGTCGCGGCAGCA
CCTTAAAGAATTACTTCAGAGAAGGCGGCAGCTGGAGAGACAGCTTGTGAGTCTTAATCCAGACCTGTATTGGAACAAGT
CTGACTAGCTGCGGCATAGCACACACGCGAGGAGTCCATCCTTCAGAAGGAGACAGATTATCTTGACAACACACCGAGCG
GAAACATTATCGCAGGGTTTGATAACTATACAAAGGGTACAACGGGCACCGCTGCAGCGCGGCGCAAAACGGGGATAACC
GAGTCAAATCGCGTCTTCTCACGTAGCAGCATATCCTACAACACTGCTGCTGGCAATTCCGGCTCATCATCATCGCACCC
GCCCACCCCTCTGCAGACGTCGTTCAAAGATGGAGGCATCAGCAGCGGGCCTGGATCCGGGCAGGCGACGCCAACATCAG
CATCGGCTGCCAAGGCGCCACATGGTATTAAGAAAAAAAAGGGACTAACTGCAACGGCAGCGGCAGCTGCGGACGACAGT
GAGACGGACACACGTGAGACGACCAAAAAAGTACGGACGAGCTTCGGTGCTGTGCGGAAATAATAGAACCTGGGACGCCG
AAGATACGTTAGCCGGTAGCCAAGATTTGATTGAGTATTGCAGTTAATGGGCTCGAAAAAAGAACCAGTCTTTCTGTACA
TGTCCGCTGTTGGGGGCCGGACATAGTACACATACCAGCGCGAGGTATTCTGCTTTTCACATGTGGCATTCTAAGAACAG
AGCTACATGAGGCGTTACAGTACTAACTAGCCGGTAGGCACTAGATGTGGCTTGCTGTATTATTCATCAAAGGAAACTAA
GTGAATTCGCCTCGTGTGTCATGCCACGAACAATGCTCTAAGTACTATGGTATCATATTTGCTCAGTGGACGCAGTAAAT
ATACTCGTAGTGCGTTCGAAGATGGATATACAAACACGTGGCGACATTCGACATTTGGGGTCCTCATCAGGCTACTAAGT
ACGAAGTAGAAACGTGCAATCCATGAAGCTCGTTTTAGCGGCCCCTCCTCTAGTAGGCAAGTGCGGGGCTTTTCGTCGAT
GCAACCGTTCTTGCTTGCTCCTTCGATTTATATGAGATGATGACTTTGCTCGTAACATAACGAAGTGCTATTAAAGCAGA
CGTCGTACCAACAAACCTAACATTGTGACTAAGCAGCAACAGGATTTTACGCCAATTCTGAGTGTGGAGGAATCTTTTTT
TTTTCAGATCATAACTTTCTACCCGTCCTACTTCAACGTCTGCAGCGATGGTTCTCAAAGCGACAAAGTTCACGCCCGAA
GTGCTTCTATCGGCCCCACGCCGCTCCGCCGGTGCTCCAAATTCTACGGGGAAGAAGGTCCTTTACACGGTAGGAAACCC
CCTTCTTAGTATTGGGTTAGTGCGTATCCCTAGCTGACAAACACAGGTATCGACATATTCCTTCCGGGAGCACCGCAAGG
CGTCCCAGATCCGCGTGCTCGATGTTAAATCGGGCGAGTCCACCGTGCTGTATGAGGACCCCGCCTACACTGAGCCCGTG
TGGATAGGATCGGACGAGTTTCTCTTCCTCAAGGCCGGCGATAAGGGGACTACCCATTTACTGTTGGGAGATGCATCTCG
ACCCGGTAGCCCGCCCACAGGCATTCGGACTTTTGACGGTGGCTTATCTAACCTCAAAGTGTTGCCCCTTTCCGACGGCG
CCATCGCTATTGCCCTCACCGGACTGTCGGACAAAACTGGCCTGCTTTTCAACCCGGACTCTGACGCCGAAAAAGGCAAG
CCCACGCACACGACTGCACGCGTGTACTCCAAGCTTTTCGTTCGTCATTGGGATGCCTACGTCACGGAGAACAGACAGAC
TGTTTGGTATGGCCGCCTTGAGCGAACGGGCGAAAATTCTGCGAAAACGTCAGGGCGATATAGTCTCGTGTCGAATGGTC
AGGCCAACGGACTTACCAATGCTCTAGCTGGCACCAAGCTGCAGTCACCGGTGCCACCGTTTGGTGGCTCCAGTGACTTT
GCTCTCGGCCCACACGGCATTGCTTTTGTGTCTCGCGACCCGGCCTACAACGAGGCTATCTACACAGTCTCTAACCTCTA
TTTTATCCCCATAAAAACATATGCCGAGCCAAAACCCCTTGCGCCTCCGTATGCTGTCAAAACAGGCGCTCTTGCCGGCT
ACAGTGCCGGTCCCGTTTTCTCGCCCAGTGGGAACAGTCTGGTATTCTCGCGTATGCGCAGTCACCAATATGAGAGCGAT
AAGCCTCGCCTTTTGTTGGTGCCAGAGATCGAAAAACTCGGTGCAGACATTATTGGCAAGAGCGACGAGTTTGAGTTTTA
CGAGACCGAAGATGGCGTTGGTGCTTGGGATGCTCGACCCGATGCCGTTGCTTGGAGCGCCGACGGCGCGGAGTTATTTG
TCACGGCCGAGCACCATGGACGCAACGCGCTGTATCGCCTGCCTTCAGACCCCAGGCATACCACATCCTTTGGTGCACCT
CAGCTCCTTGTTGGTGGCCACGAGGTATTCGAGGATGAGAAAATTGACGCTTCCCACGATGACAGTGGTAGTGGCGTCAC
TGGCGATGAGTCTGTAGGATTCAGACGCCTGGGTGGTCATGGCAGTGTTTCTGATGTGCGGCTGCTTGCTAGTGGGATTG
ACGGTGATACTCGACTCTTCCTAAGCTTAAACTCTCTGGTTGACAACTCCTTTTTTTGCATTCTCGACCCAGAGCCTACG
GCTGTCTCAACATCAAAGTTCCCACGAACAATTTTGCAGGCCGTGTCATCGCAGTCCCGCCATGGCTCAGCTTTCGGTCT
ATCGCCGAAACAAGTGGGCGAGATATGGTATAAGGGTGCGGGCAACTATCAGGTTCAGGCATTGGTGGTGCGGCCGTCAG
ATTTTGGTGCCGAAAAGAATAAGAATCGCAAGTGGCCGCTGGCATTATTGATCCATGGTGGACCCCAGGGAGCCTGGAAC
AACAGCTGGAGCACGCGCTGGAATCCTGCTGTGTTTGCAGAACAAGGCTACGTCGTCGTCGCGCCTAATCCGACGGGCAG
TACGGGCTACGGGATGGCGCTCCAGGATGGCATCCGTAACCAATGGGGTGGGCTGCCGTACAAAGATATTGTGCGAGCCG
TAGACTACGTGGAAGCTGTCTTCCCGTACGTGGACATTTCACGAGCCGTTGCTCTCGGCGCATCATATGGTGGCTATATG
ATGAGTGAGTGTGATACTCCGCCCGATCTCTTGTATTGACAGTCTTCTGACTTCGACCCTTTCAGACTGGATCCAAGGTC
AGCCGCTGGGCCGTCGCTTTAAGGCTCTTGTCAATCATGATGGTGTCTTCAGCACGCTCAACCAGTACTCATCAGAGGAG
CTTTTTTTTCCGCTCCATGATTTTGGTGGATCACTCTGGGACAATCGTGCCGGTTATGAACGGTGGGACCCTGCCAAATT
CACCGACAACTGGGCCACGCCTACGCTTGTACGATGTCTCTCCCTTCCCTGCTACTTATGCATTTATCAGAATGCTTGTT
ACCATTCCCAGGCTAACCAATGAGATCATTCACAACGAACTTGACTATCGCCTTCCCGTCACTGAGGGACTGGCTGCATT
TAACGTACTTCAAAGTCGCAATATACCAAGCCGGTTTCTCTCATTCTCAGACGAAAACCACGTGAGCATCCAAATTCGCC
AGCTTCTGAGAAGAAACACAGTAAGAAGGCTAACATTTTGTTCGTCCAAACAGTGGGTTCTAAAACCAGAGAATTCACTC
GTGTGGCACAAAGAAGTGCTAACCTGGATCAACAAGTACGTCGGTGTCGGCGACGAATTTGAAAAAAAAGCGAACGCTGC
CAACCTGGTTGGCAACATGGCAAATCTCGATCTCCCGCAAGTGGAGCGGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62