GenePrediction:GLEAN_1987 Details

Name: GLEAN_1987
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2383237..2384090 (+ strand)
Length: 854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2383237..2383459 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_144:2383525..2384090 (+ strand)
Length: 566
>GLEAN_1987 class=GenePrediction position=GCSC_144:2383237..2384090 (+ strand)
ATGATCTTCACTGCCGCCTCCATTCTCGCGCTGGCCGTCTCGGCGCTGGCCCAGACCGCAGGTTTTGACGCCATCTCGAA
GCCGACCGATAATGAACAGCTGACCGCTGGCGACTCCTACGCCATTACCTGGGAGCCCAGCTCTACGTACACAGGCACTG
TCTCCATTGCGCTTCTTGGTGGTGCCACTCCCCAGACTCTTCAAGTGTTGTCGACTATCTCGAGTAGGATTCTTTCTCCA
GTCTATTTTTATTTGTCTTCAGGGAGTCCTGACTAATCAAACTCACAGGCGGTGTCAAGAACAGCGTTGGCTCGTACAGC
TGGTCTGTCGGATCCGACCTGGGCACTCTGGAGACATACGGCATCCGTATCACCCTCGACTCGGACACGTCCGTGTTCCA
ATACTCGTATCCTTTCCACATCACCGCCAGCGAGGCTAAGAAGACGACAGCTACTGGCACCACATCGTCTAGCAGCACGG
CTACTGTCGCCCTCTCCACCACGTCCTCCATTCTAGCACCTGTCACCACTGTTTCGACTGCTATTGAAACGAGCACTACA
TGCACCGCCAGCGCTTCGGTCTCTTCCGCCCCAGCGACATCTGCGCAGCTGATTGCCCATATCTACAACTCCACCGCATC
GGCTCCCACAACTTTGGCCACGGCCGTGTCCTCGGCTGGCAGCCTGTACACTACCAAGTCTTCAAACTACACTAAGGTCG
CCTTTACTGGCACTGCCTCTGCGAACCAGACAACCGCGACTTCCACAGTGGTCCAGGCTGGTGCTACTTCAAATGCGGCT
AGCTTCTTCGCTGCCCTGGCTGGCGGCCTGGCCGTATCATTCTTCCTCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62