GenePrediction:GLEAN_198 Details

Name: GLEAN_198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:167373..168312 (+ strand)
Length: 940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:167373..167536 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_167:167748..168312 (+ strand)
Length: 565
>GLEAN_198 class=GenePrediction position=GCSC_167:167373..168312 (+ strand)
ATGAGCGGCGAAGACCCGTCAGAGCGCCCGGAGGCCATCTCCGCCATCATCAATGGGCTGGAGCGGTACAACCCCGAGGC
CGTCGTTCACCTGGAGGCATACCTGGCACAACAATGCGAGGAGCGGTTCTGCGACTGCAATGCGAACCGGACTCTCCTGA
AGCTGTACGTGTTCTCCTCCCGTTATTAGGCTATCTGATTCTGGTTTCCTCTGCCACTATTTTAATGATGACTTAAAAAA
CGTTTCCTATTACCTGACCTCTCATGAAGTCAACTGTTGAACTCTCTGATCTATGGCTTGTGTTTTGTTTTTTGTGTCCA
AAGTGAGAAGAATGATGGAGGAGCTAGAATGCTAAATCTCCTCTACGCCCCCCAGGTACCAGCTCAACCCGGACCGGATC
AAGGATGAGGTCATCACCAACATCCTCGTCAAGGCCATGACCCAGTTTCCCTCGCCGCAGTTCAGCTTGGGCCTGCACCT
GCTAGGCCCGACCGCCGCCTCCACCACTGCTGCTGCTGCTTCGTCCACCTCTGGCGCCTCTGAATTGGCCGAGGCCGTGT
CCAAGCTGCGCGCGCTCAACAACCTGCTCGAGGGCGCCCAGTACGCCCGCTTCTGGGCCACGCTCGACTCCGACGACCTG
TACGCTGACCTGACCACCGACATTGATGGCTTTGAGGAGATTGTCCGCGTGCGCATCGCCCAGCTCATCAGCCACGCCTT
CCGCGAGATCCAGCTAAGCCTACTGGAGCAGTGGCTTGGCCTGAACGAGGATGCTGTCCGCAAATTCGTCACCGGCACCT
GCGGCTGGAAGGTCGAAGGTACCTCAGCTATCATCCCCAAAAACCCCGAGAACGAGGCGAAGAAGTCAGAGATCCGCGAG
GACGTGAACATCGACATGTTTGCCCGGGTCATTCGGAGGTCTTGGGAAGAGGCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62