GenePrediction:GLEAN_1990 Details

Name: GLEAN_1990
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2395144..2397552 (+ strand)
Length: 2409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2395144..2395389 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_144:2395448..2396616 (+ strand)
Length: 1169
Type: CDS
Source: GLEAN
Position: GCSC_144:2396686..2396798 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_144:2396870..2397552 (+ strand)
Length: 683
>GLEAN_1990 class=GenePrediction position=GCSC_144:2395144..2397552 (+ strand)
ATGCAGTCTCAGAGCAGTTCTGGCGGTACCAGTGCTGCCCCGGCACAGCCGCCATCAAAGGGCAACGCAGCCGCGCCAAA
GCTCAACAATGAGCTGGAGCTCGGTGACATGCCTGGCAGCGGGCCTTCCGAGCCTGACATTATGAATCTTGCAAGGACAG
GTGACATTTCCGGCATGCAGAAACTGCTCGAGGCAGGTAACCTGGACGCCCCGTACACGGACGCAGAGGGGATCACACCT
TTACATGTATGTTCTTGCATTCATATCTAGCTATCTTTGTCTCTGGCCTTGCTAACTCGACCAGTGGGCTGCCATCAATA
ACCAGTACGCCATGTGCAAATTTCTCCTCGACAGCGGCGCGCCTATCAATAAGAAAGGCGGCGAGTCCGTCGCCACCCCT
CTGCAGTGGGCCGCCCAGCGCTGTCACTATTACACCGTCCACCTCCTCCTCCAGCACGGTGCCGACCCCCTCATTACCGA
CTCTCAGGGTTATAATACGCTGCATATCAGCACCTTTAATGGAAACGTCCTGTTGCTTGTGCTTCTGTTGCATCAGGGCA
TCCCCGTCGACGTCGTTGACGGGTTCGGCCATACCGGCCTCATGTGGTCTGCATACAAGGGTTTTCCGGCATGTGTTGAC
CTCTTCTTACGGTGGGGTGCCAATGTTGAGGCCCAGGACGAGCAAGGTTTCACCGCGCTACACTGGGCTCTGGTCAAAGG
CAGTCCCGGTTGTATCCAAAAAATTATCGAGTACGGCGCAGACCGCTTCGCCAAGACGGCCACGGGCAAGACACCAGCCA
TTACAGCACAGGAACTGAATACAGTTACGGCATGGCACAGGGGGCTGAAGGAGAGCGGATACGACGAGGACGGCAGCCCA
GAAATACCAACATTCCCTGGGGCCATCTACTTTTCGAAAGATCGGCGGGGATTTGTCACCAAGCTCTTGTTTCTTTGGCC
CTTTGTGATCATTTGGGCCGTGATTGCCTTGCTTGCTGGTTTGCCCATTTTTGCTGGTGTGCCATTATCATTCCTCACTG
GTTATAGTATGCAATGGGTAGCCCAGAAGGTCGTTCATTATGCGCCCCCCGACATGCGCCAACTGCAAAAGACCCCATGG
CTTTCCGGAATTTTCGCTGGATCCTTGTTTCTCGTCGGCGTGAATTGGTTGACTAATGTACTGCCGGCAACGACCTGGCA
AGCCAAGACCCAGGACGATACGAACTGGGCGATAAACTTTTGTTTTGCACTCTTCTACTCCATGGTCACATATTTCTACG
TTGTTTGCATGGTTTCTGATCCGGGCTTTGTTCCCAAGCTCAACGGCATTGCAGAGCAGAAGGCCGTCATCGACGAACTA
ATTGCGGAATGGAAGTTTGACGACTCCAACTTTTGCGTGACTTGCATGATCCGAACGCCACTGCGCAGCAAGCACTGCCG
TCGCTGTCAACGTTGTGTTGCAAAGCACGATCAGTAAGTTTCGCTTGTTGTGATTAATTTGAAAAAGATGCTGAAATTTG
AAGGCTGACGATCGCTTCGCAGCCACTGTCCATGGGTGTACAACTGCATTGCTGTCAATAACCACAGACAGTTTTTTCTC
TATTTGATCAACCTCACCATTGCAATTGTCATACATGATTGGATTGTTTATTGCTGTAAGTGATCCTCTTGAATGCTCAA
GCCTATTTGACTAGGTACCGTTTCTCTGACTCTGCCGTTCTTTTAGACCTTTCCTCTCGATCTGCAGACACGTCTGATCT
GTGCAACATTCTCTCCCCCTCTCTGTGCAAGGTCGCCAACGCCGGGACATTTACTCTTCTTGCTGCCGTCTGGGCGACTT
TGCAGTTGTCGTGGGTGTCTATGCTTTTGTTTGTACAGTTCATTCAGGTCTCACGCGCCATGACAACATACGAGAACATG
TATGGTATCGATCGCCATGCAGCTGGCTCTCTGACTTCGGCGTTCACGTCAACAGGGGCACCGCTAAATCCCAACCACCC
AGATGCCATTCCGCCTTCCGGTGCTACAGGAACACCCGACAGCAGCGGGCGCGGATCGCACGGCCATCACCATCACGGCC
ACGACCATGGTGGATTTCTCAAGCAATGGAGCCGAATTTTGGGTGTGGACACCTTCATCGAAACCGCGACTGGTCGTGGG
GCAGCAACAGGCAAACAGAAAAAGCAGCGAAAAAACCCGTATTCGCGTGGGTGTATTACCAATTGTAAGGACTTTTGGTG
TGATCCAGCTCCAATCTTTGGCCACCGGGAGACTGGTGCTGCGGTGCTAGGCGGCAAAAATATCAACTACACCGAAATGT
ACGAGTCCCCTACACTAATGGAACTCTCCAGGGTGCGGAAAGGTGGCGAGAGAGGTGCTTACGAGGCTGTTGCTGTAGAG
GAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62