GenePrediction:GLEAN_1993 Details

Name: GLEAN_1993
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2446405..2448583 (+ strand)
Length: 2179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2446405..2446519 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_144:2446581..2448583 (+ strand)
Length: 2003
>GLEAN_1993 class=GenePrediction position=GCSC_144:2446405..2448583 (+ strand)
ATGAACATAGACACGACGTCTATTTCGGGATACACGATCTATCGGGAAGAGGACAATGGTTCCTCAGCAATAGATCCAGT
CCCTCTTCCGCTCAACGAGCTGGTCCATCCTCTAGGTCAGTAAATGCGACTTTCGTATGTCAGGTTATGGAGCTAATTTT
GTTGTGGCGTATCTAGATCAGCTGTCGATTGAAGAAATCTCACTCGCTGCTAAGATTATTCGCCATTATGCCAATCCTAA
GGCTATCAGGTTTAATTGCATCACTCTTCGCGAGCCACCTAAGACTGAGTATACTGCCTTCCGAGATAACCAGAGCTCTC
GCCCTGAGCGAAAGGCTTTCGCCATCATCTTGGAAAATGGAACTTCGGTTGTAGCGGAAGTCATTGCCAACCTAGCTACA
GCCAAGGTAGAGGTTTGGAAGGTAGTGCAAGATGTCTGTCCCACGCTCACGCTTGAAGACCTCGACGTGACCGAGCGCGT
TTGTCGCAATCACCCCGAAGTGGTGAAGGTGTGCCGCGAAATCGGTATTACAGACATGTCGAAGGTCTTCATCGACGCAT
GGGCTATTGGATTTGATGACCGGTGGGGCCGTGACAGACGTCTCCAGCAGGGCATCTCATACTACCGCAACTCTGCCCTA
GACAATCAGTATGCTCATCCTCTGGACTTCACCGTTGTGGTTGATACTGAGAAAGAGGAGCTTCTGTCTGTGGACATTCG
CCGTGTCAATGGTGAGCGTACCGCCGTGTCTCTCGCGGCGGACAATTTCCTCCCGCAATTTATCCAGAACAGGTACATCG
GCGACAGACTGAAGCCGATTGATATCACCCAGCCGGAAGGGGTGTCGTTCAGCCTCAACGGAAATGAGATCTCGTGGGCT
GGATTTCACATGCACATTGGTTTCAACTACCGAGAGGGCATTGTCCTTTCCGACGTGCGTGTGGACGACCCTGAGGAAGG
CCGCCAGCGAAACTTGTTCAACCGCATTAGTGTTGTCGAGATGGTCGTTCCTTACGGCGAACCAAGTTCGCCACACCAAA
GGAAGCATGCCTTTGATGTTGGCGAATATGGCAGTGGCCTGATGACAAATCCCCTCCAATTAGGATGCGACTGCAAAGGC
ACCATCCATTACCTTGATGCCGTCATGGCGACGGCCCGTGGCGAGCCAGCGGTTGTGAAGAATGCTATCTGCATACATGA
GGAGGACAACGGCCTTCTGTACAAGCATACTGACTACCGTGACGGCACTGTGGTTTCGGCTCGTGACCGCAGACTGATCA
TTTCGCAGATCATCACGGCTGCCAACTATGACTACTGCTTCTACCACATCTTCACACTGGATGGAACCTACAAGCTCGAG
GTGAAGCTGACAGGGCAACTGAACACAAGCAGTATGCATCCCTCAGAGACAGCAGCGCCTTACGGCACGGAAGTCGCTCC
ACGCATCAATGCCCACAACCATCAGCATATCTTTTCGCTTCGCGTCGACCCTGAAATTGACGGGCCGAACAATTCAGTGG
TGCAGACAGATGCTGTTGCGGCCGACGAGCCTGCTGGATCTGCAGCAAATCAATATGGCAATGGATTTCACGCCAAGAAG
ACGCTTCTTCGAACGGCAAAGGAGGGGGCCACGAGCTACTGCCATGAAACGAGCCGGTCCTGGAACATAATCAATCCCGC
CGTCACGACCACTGCATCCGGTGCCCCAGTTGGATACAAAATTATAAACAGCAGTTGCCCAGCGATTCTTGCCAGGCCTG
GTAGCAGGGTGTGGAAACGTGCCGCTTTCGCGCGTGAGAGCTTGTTCGTTGTGCCATACGAGGACTACGTGTTGTTCCCA
GCTGGGGACTATGTCTGTCAGAGCTCGGGTGAGTTGGGGCACCCACACAACAAGACTGTTCTTGACTGGGTGGAGCAAGA
CGGGTCGATTGAGAACACCGACATCGTCTGCTACATCCAGTTTGGCTTGACGCACTTTCCCCGTTGCGAGGACTACCCCA
TCATGCCCTGCGAGCCGGTTGGTGTCATGCTACGCGCCGCCAACTTCTTCAAGCGAAACCCGGTTTTGTGGGTGCCCCCG
TCTTCCATGGCCGTGGATACCACCTCGCAGATTGCCTTCTCCGAGCCGTCGAAGAAAATCCCAGCGTGCCATGCTGCCAA
GCTCCCGCATAGATTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62