GenePrediction:GLEAN_199 Details

Name: GLEAN_199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:178956..182817 (+ strand)
Length: 3862
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:178956..179371 (+ strand)
Length: 416
Type: CDS
Source: GLEAN
Position: GCSC_167:179421..179730 (+ strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_167:179787..180065 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_167:180610..182817 (+ strand)
Length: 2208
>GLEAN_199 class=GenePrediction position=GCSC_167:178956..182817 (+ strand)
ATGGTGTCCAAAAAGATGACGGTGCAGGGATCGGGGATCATTGATTCCATGTCTTCTGATTTAGACAAACAGATGGTGAG
GCTAAAGTCTCCTCCCTTTGAGGAACCCATCCGATCGGACAGCATAAGGACATTCCGAGTGCGCGGCGTTCCCAAGGACT
GGACAGAGGACAATCTAGAGGCTCGTCTTACTGCAACGTACGGAGAAGAACTTCCTACTGTTGAGTCTTTGGCCGTCGAG
TACGACGGACAATGGCAGACGGCCACAGTCTCCTTTCCATCGACGTTCCCGACCGGAGAAAGCAGGATTAAAATTGAAGG
ATCACGTCGCAATAGAGGCACCTCCCTCACAGTCGATGATGGCTTCATCGGTATCACGACGCTCCACAAACCCGCCCCCG
AAGACCACAAATACGAGTAAGTGCTGTTCTGATTTGAAAGCAACTTCACTACTAACTACGCCTAGCCTGATTGCTGTCCC
CGGTCTGGGAGCGCATGCATTCGGCTCGTTCAAGGAGCGTGGCGGAGATCACATGTGGCTGCGAGATGCGCTGCCGGCCT
ACATGGCCGGCACGGGCAAGTCAAACACACGCGTGATGACGTACGGCTACGAAGCTAGCCTGAGTGATAGCCGGAACTTT
CAGGGGCTGTCCGACATCGGGATTGCGTTTATGCATTCTGTTTTTGATGCCACACAAGGTCCTAATTCGGCAGGTAGCGA
CTCCCGCCCGATCATCTTCGTAGCCCATAGCCTCGGGGGCCTGGTCGTCAAGCAGGTGAATATAGACTGCAGCACCCAGA
ACGAATGTTGCAAGATTCTAACAGTTCAAAGGCCCTTATAGCATTGCAAGAATCCAAGGAGCCGGAGCACATGCGACTTC
TTCGTGCTGTGCGTGGGATTGCTTTCTTTGGTGTCCCAAATGACGGTATGAACATAGGATCTCTCAAGGCCATGGTAGGA
GATCGGCCGAATCGGCAGCTGCTCGAATCGATCGGCAGCGACGCAGATTTTCTACGGCGACAATACCAGGATTTCCAAAA
ATTTCTTCAAATGTATGACCCGGTCATCATTTCTTTCTATGAAACCAACGAATCTCCAACGGCCCAAATGGTAAGTCAAT
ATTACAAGCCAGTCGCTGCAAGGGTCTTACTGACGGCAGGTAGGATGAGAATGGGAAGTGGAGTATGAACGGGCCGCATG
CAGTATTGGTGTCTATTGCGTCGGCCACGCATTGTAAACCAAACGGGAATAATATGAGCGATACTTGTGCTTTGGCTTGC
GCTCATTCGGAGTTGGTCAAGTTTGCGCAGCATGATGCGCGTTCTCTCTTGGCGCTGGGACGGCTTAAAGCTCTTATTCA
GAAAGCGAGTATGTGTAAAGAAGCTCCTAGCAAATGGAGCTGGCGTTAATATTTGCAGACCCATTACACATAATACTATC
AGACCCGGAGATAAAGTGCCTACAGTCATTAGCATTTCCACACATGCAGGATCGCGCCAACAATGTGAAGCTCGCTACCG
AGGGAACATGTCAGTGGCTTTTGGAACACCCAAATTACCGGGACTGGGCCATTTCTGGCCAGGCCGTGCTCTGGATCAAG
GGAAAGCCCGGCTCGGGGAAGTCGACGCTTCTCAAACACGCCCTGCGCAATCAGGCAGCTGCTCCAAGCGCTCGGCCTAC
CGATCTTGTCTTGTCCTTCTTCTTCCACGGTCGCGGCCATGACCTGCAGAGAACATCGCTGGGACTCATTAGATATCTTC
TTCACCAGGTTCTTGAACAATTACCAACGGTATTGCAAGGACTCGTCGACATGTCTAAACAGAAGAGCAGCCAATTCAAG
GAGAATAAGTGGCATTGGAATGAGAATGAGCTCTGGCCCTTCTTCGAGTCAGCAATCCCAGAGATTCTCGAGAAACGTTC
CGTTTGGTTGTTTACCGATGCCTTGGATGAGTGTGGCGAGGATAGTGCAACAGTCGTCATCGAGAGGTTTCTATCCCTGA
TCACCAAACTCTCGGCCCGCGCCTCAGACCATCACCGCTTTCGCATCTGCTTCGCCTGTCGTCCTTATCCAGTCCAGGAC
TGGAAGAACGGTCTGGAAATACATCCCGAAGACAACAACAAGGCCGACATTTCGACTTTTGTGATGACCCAACTATCGCA
TGTGGATCCGGCCATTTCAGAACTTGTCATCCGCCAAGCTTCTGGGGTGTTCTTGTGGGTGGATCTGGTGGTAAGGAAAG
TTCGGAAGCTCACAAAGAAAGGTACCTCTCCAGCGAAAATCCAGGCTGCTATAGCAGCCATTCCGCAAGACCTCTATTCA
CTATACGCCGATCTCATTCAGCAAATGAACGCTGCCTCTCTGAGGATGTTTCAATGGGTTTTATTTGCTACTCGGCCTTT
GTCGCTAAATGAGCTACGCTGGGCCATGGAGATCAGACCCGATCGCCCATCCTCTTCAAACGCCTATACGATGGACAATG
AACAAATGAGCCGACAAGTACAAACTCTGAGTTGTGGGCTTCTTGAGGTCACTGCGACGCCTGAAGGTCATGTCCAGTTC
ATTCACCAGTCGGTCAAGGACTTTTTCAACAAGAAGTTGACCGATTTAGACAGCCGCTTTCCTCCCCGCAACAGCTTGCC
ATCGTCTACTCTCGCGATTGGACGGGCATACTACCAACTGTCTAGAGCCTGCATTCGCTATTTGAAAAGGGAAGAGCTGC
AAAATACCCGGCTGAGCCCTTATACGATGTTTTCCAGATACCCTTTCCTTAAATACGCACTGACCTCATGGTTAACGCAC
ACACTGCAAAGCGCCAAGTATGGCGTCCCCATGAAAGATATTCTGGGACTGTTTGACTGGCCGTCAAATTCCTTCGTTGC
TTTTTTGGCGCATATCGAACAGATTCTGAGGCTCATGCCGGAAAACTATAGGCTGAATCATATATCAAAGGGATCCAGTT
TAGTCCACATTGCAGCAAGATTTGGGATTCAAGAGCTTTTGTCAGACATCATCAAGTCCAGCCACGATCACATTGACGAT
CGGGACGAAGACGGCATGACACCGTTATCTTTTGCTGCAGAGAAAGGGCACAAGGCGGTAGTTCAACTACTACTTGCTAC
GAAAAACGTCAAAGTTGATTCGAAAGATACTCTCGGCAAGACGCCGTTGTCTCGAGCTGCTGGGAGTGGGCATGACGATG
TGGTTGCGCTACTACTAGCTACGAACACTGTCGATGTTAACTCGACAGACCTTTACTACGGCCAGACACCGTTGTGTTGG
GCTGCTAAGCAAGGGCACAAGGCGGTAGTCCGGCTACTGTTAGCTACAAAAAAGGTCATTGCTGATTCAAGGGACGAAAA
CGGCCGGACACCGTTGTCTTTGGCTGCTGAGAATGGGCACGAGGCCGTGGTTGAGCTACTAGTAGCTGCGAACAATGTCG
ATGTCAATTCGAAAGCTGTTCACGGTCAGACACCGCTCTCTCGGGCTGCTGAAAATGGGCACGAGGCTGTGGTTCGGCTA
CTACTAGCTACGAAAAACGTCAACGTTGACTCGAAAGATTCCGTATACGGCCAGACACCGTTGTCTTGTGCTGCTGAGAA
GGGACACGAGGCGGTGGTTAGGCTACTGTTAGCTACGAACGGCGTCAATGCTGATTCGAGGGACGAATTCGGTCGGACGC
CGTTGTCTTGGGCTGCTGAGAATGGACACGAGGCAGTGGTCAAGCTACTAGTCGCTACGAACGGCGTCAATGTCAATTCG
ACAGATGTCTACGATAATACGCTGGTTCATAGGGCTGCTGAGCAGGGGCACAAGGCTATTGCCGAGCTACTGCAAATGGA
GATACAACGTCGTGGAAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62